Ecology

Habitat

Depth range based on 20 specimens in 2 taxa.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 0.5 - 8
  Temperature range (°C): 25.121 - 28.488
  Nitrate (umol/L): 0.058 - 0.617
  Salinity (PPS): 33.667 - 34.975
  Oxygen (ml/l): 4.447 - 4.785
  Phosphate (umol/l): 0.069 - 0.216
  Silicate (umol/l): 1.005 - 2.415

Graphical representation

Depth range (m): 0.5 - 8

Temperature range (°C): 25.121 - 28.488

Nitrate (umol/L): 0.058 - 0.617

Salinity (PPS): 33.667 - 34.975

Oxygen (ml/l): 4.447 - 4.785

Phosphate (umol/l): 0.069 - 0.216

Silicate (umol/l): 1.005 - 2.415
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cypraea annulus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AGACTATTAATTCGAGCTGAACTAGGCCAACCAGGAGCTCTTCTGGGGGAT---GATCAATTATATAATGTAATTGTAACCGCCCACGCTTTTGTTATAATTTTCTTTTTAGTAATACCTATAATGATTGGGGGATTTGGAAACTGATTAGTTCCTTTAATACTAGGAGCCCCAGACATGGCATTCCCACGTCTAAATAATATAAGTTTCTGACTTCTTCCGCCTGCCCTTCTACTACTCCTTTCTTCAGCAGCAGTCGAAAGTGGAGTTGGAACTGGATGAACCGTCTACCCTCCTTTAGCCGGAAACCTTGCTCACGCAGGTGGGTCTGTAGATCTAGCTATTTTTTCTCTCCACCTAGCAGGTGTNTCATCTATTCTNGGTGCTGTAAACTTCATTACAACTATTATTAACATACGATGACGAGGCATGCATTTNGAACGACTTCCCCTATTTGTATGATCTGTGAAAATTACTGCCATCCTACTTCTCCTCTCTCTACCAGTTTTAGCAGGTGCTATTACAATGTTATTAACAGACCGAAACTTTAACACCGCTTTCTTTGATCCAGCAGGAGGTGGAGACCCTATTTTATACCAACACCTGTTTTGATTCTTTGGTCACCCAGAAGTCTACATTTTGATTTTACCAGGATTCGGTATAATTTCTCATATTGTAAGCCACTACTCTTCAAAGAAAGAGACCTTTGGAACCTTGGGTATAATTTATGCTATACTAGCAATTGGTGTTTTGGGTTTTATTGTCTGAGCTCATCATATATTCACAGTAGGAATAGACGTAGACACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cypraea annulus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Monetaria annulus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGATCAGGACTAGTTGGTACAGCTCTTAGATTATTAATTCGAGCTGAACTAGGCCAACCAGGAGCTCTTCTGGGGGAT---GATCAATTATATAATGTAATTGTAACCGCCCACGCTTTTGTTATAATTTTCTTTTTAGTAATACCTATAATGATTGGAGGATTTGGAAACTGATTAGTTCCTTTAATACTAGGAGCCCCAGACATGGCATTCCCACGTCTAAATAATATAAGTTTCTGACTTCTTCCGCCTGCCCTTCTACTACTCCTTTCTTCAGCAGCAGTCGAAAGTGGAGTTGGAACTGGATGAACCGTCTACCCTCCTTTAGCCGGAAACCTTGCTCACGCAGGTGGGTCTGTAGATCTAGCTATTTTTTCTCTCCACCTAGCAGGTGTCTCATCTATTCTGGGTGCTGTAAACTTCATTACAACTATTATTAACATACGATGACGAGGCATGCAGTTTGAACGACTTCCCCTATTTGTATGATCTGTGAAAATTACTGCCATCCTACTTCTCCTCTCTCTACCAGTTTTAGCAGGTGCTATTACAATGTTATTAACAGACCGAAACTTTAACACCGCTTTCTTTGATCCAGCAGGAGGTGGAGACCCTATTTTATACCAGCACCTGTTTTGATTTTTTGGTCAC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Monetaria annulus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 7 specimens with morphological vouchers housed at Museum of Tropical Queensland and Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Monetaria annulus

Monetaria annulus, common name the ring cowrie or gold ringer, is a species of sea snail, a cowry, a marine gastropod mollusk in the family Cypraeidae, the cowries.[1]

Description[edit]

The shell size varies between 9 mm and 50 mm

Distribution[edit]

This species and its subspecies are found in the Red Sea, and in the Indian Ocean on the coasts of Aldabra, Chagos, the Comores, the East Coast of South Africa, Kenya and Tanzania, Madagascar, the Mascarene Basin, Mauritius, Mozambique, Réunion, the Seychelles, Somalia, Yemen, Oman, Maldives, India, Sri lanka, Mozambique, in the tropical Pacific Ocean as far north as Hawaii and towards the western Pacific reaching the Galápagos islands.

Subspecies[edit]

There may be three or more subspecies:

  • Monetaria annulus camelorum,
  • Monetaria annulus sublitorea and
  • Monetaria annulus obvelata (Rochebr.)

Use as shell money[edit]

In parts of Asia, Africa and the Middle East, Monetaria annulus, the ring cowry, so-called because of the bright orange-colored ring on the back or upper side of the shell, was commonly used as shell money much like Monetaria moneta. Occasionally the ring part on its back would be hammered away, making it nearly indistinguishable from other money cowry species. Many shells of the species were found by Sir Austen Henry Layard in his excavations at Nimrud in 1845–1851. The shell was also introduced to Native Americans during and after the fur trade by European traders as a cheaper substitute [1] for highly treasured elk ivory,[2] for dowry, and for other uses as ornaments.

Images of shells[edit]

References[edit]

  1. ^ a b Monetaria annulus (Linnaeus). WoRMS (2009). Monetaria annulus (Linnaeus). Accessed through the World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=216875 on10 October 2010.
  2. ^ http://www.turtletrack.org/Issues02/Co04202002/CO_04202002_Elkteeth_Dress.htm
  • Verdcourt, B. (1954). The cowries of the East African Coast (Kenya, Tanganyika, Zanzibar and Pemba). Journal of the East Africa Natural History Society 22(4) 96: 129-144, 17 pls.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!