Overview

Brief Summary

Biology

T. forbesii spawns from November to February. Eggs and larvae are non-pelagic. Like other Opheiiids, it is generaily considered to be a non-selective deposit feeder. T. forbesii is eaten by different kinds of fish (Wolff, 1973; Fauchald & Jumars, 1979; Hayward & Ryland, 1990).
  • Holtmann, S.E.; Groenewold, A.; Schrader, K.H.M.; Asjes, J.; Craeymeersch, J.A.; Duineveld, G.C.A.; van Bostelen, A.J.; van der Meer, J. (1996). Atlas of the zoobenthos of the Dutch continental shelf. Ministry of Transport, Public Works and Water Management: Rijswijk, The Netherlands. ISBN 90-369-4301-9. 243 pp.   http://www.marinespecies.org/aphia.php?p=sourcedetails&id=83 External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Beaufort Sea, Belgian Exclusive Economic Zone, Canadian part of the Arctic Ocean, Dutch Exclusive Economic Zone, European waters (ERMS scope), Golfe Normanno-Breton, Gulf of St. Lawrence, Irish Exclusive economic Zone, Manicouagan, North East Atlantic, North West Atlantic, Portuguese Exclusive Economic Zone, Roscoff, Saint Lawrence River, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The distribution of T. forbesii comprises the subtidal zone in the western Wadden Sea, the Southern Bight and sorne locations in the Voordelta. Some individuals have been found at the Cleaver Bank, the Dogger Bank and in the north-eastern part of the area.
  • Holtmann, S.E.; Groenewold, A.; Schrader, K.H.M.; Asjes, J.; Craeymeersch, J.A.; Duineveld, G.C.A.; van Bostelen, A.J.; van der Meer, J. (1996). Atlas of the zoobenthos of the Dutch continental shelf. Ministry of Transport, Public Works and Water Management: Rijswijk, The Netherlands. ISBN 90-369-4301-9. 243 pp.   http://www.marinespecies.org/aphia.php?p=sourcedetails&id=83 External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: eastern Bradelle Valley), Magdalen Islands (from eastern Bradelle valley to the west, as far as Cape North, including the Cape Breton Channel); lower North Shore
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Morphology

Like Ophelia borealis, T. forbesii is a short, spindle-shaped worm with a conical head, circular in cross section anteriorly, but without a clear ventral groove in the hind part. The body is made up of 30 segments and rneasures about 30 mm in length and 7 mm in width. Parapodia are inconspicuous, but finger-like gills are present from the second segment onwards. T. forbesii is whitish or flesh pink in colour and may be encrusted with sand. This species gives of a strong garlic-like smell when collected (Hartmann-Schröder, 1971; Hayward & Ryland, 1990).
  • Holtmann, S.E.; Groenewold, A.; Schrader, K.H.M.; Asjes, J.; Craeymeersch, J.A.; Duineveld, G.C.A.; van Bostelen, A.J.; van der Meer, J. (1996). Atlas of the zoobenthos of the Dutch continental shelf. Ministry of Transport, Public Works and Water Management: Rijswijk, The Netherlands. ISBN 90-369-4301-9. 243 pp.   http://www.marinespecies.org/aphia.php?p=sourcedetails&id=83 External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

The species has been mainly found in medium to coarse sand with a very low silt content. T. forbesii is reported as a species inhabiting coarse to fine sand, and (rarely) mud (Hartmann- Schröder, 1971; Wolff, 1973; Hayward & Ryland, 1990).
  • Holtmann, S.E.; Groenewold, A.; Schrader, K.H.M.; Asjes, J.; Craeymeersch, J.A.; Duineveld, G.C.A.; van Bostelen, A.J.; van der Meer, J. (1996). Atlas of the zoobenthos of the Dutch continental shelf. Ministry of Transport, Public Works and Water Management: Rijswijk, The Netherlands. ISBN 90-369-4301-9. 243 pp.   http://www.marinespecies.org/aphia.php?p=sourcedetails&id=83 External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

intertidal and infralittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 312 specimens in 1 taxon.
Water temperature and chemistry ranges based on 197 samples.

Environmental ranges
  Depth range (m): 0 - 184
  Temperature range (°C): 0.606 - 17.229
  Nitrate (umol/L): 1.508 - 16.736
  Salinity (PPS): 10.036 - 35.574
  Oxygen (ml/l): 3.996 - 7.537
  Phosphate (umol/l): 0.091 - 1.503
  Silicate (umol/l): 2.052 - 24.216

Graphical representation

Depth range (m): 0 - 184

Temperature range (°C): 0.606 - 17.229

Nitrate (umol/L): 1.508 - 16.736

Salinity (PPS): 10.036 - 35.574

Oxygen (ml/l): 3.996 - 7.537

Phosphate (umol/l): 0.091 - 1.503

Silicate (umol/l): 2.052 - 24.216
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Travisia forbesii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGCACCATGTATCTGGTCGTTGCTCTTGTCATGTTTTTCGTTGCAGGGGCAATGGCGCTGTTGATTCGTCTGGAGCTATTCCAGCCCGGCTTGCAGTTCATCCGGCCTGATCTCTACAACGGGTTAATTACCATGCATGGGCTTGCCATGGTATTTGGCGTTGTGATGCCAGCGATGACAGGC---CTTGCCAATTGGCTGGTGCCGATGATGCTGGGCGCACCAGATATGGCGCTGCCAAGGGTGAACAACTGGGGTTTTTGGTTGTTGCCGCTTGGGCTGGGCATATTAGTGGCCACGATGTTCATGCCAGGCGGTGGACCGGCCAGTGGCTGGACGATGTACCCGCCACTTATGTTGCAAACA------GGCTTTTCTTTTCCGTTTATTATTTTTGCGGTGCATATTCTGGGCATCTCTTCGGTCATGGGCGGCATTAATGTGGCGGCCACGATTTTTAACATGCGTGCCCCAGGGCTTACCTTGATGCGCATGCCGTTATTTGTTTGGACATGGCTCATCACGGCGTTTCTTATTATTACGGCGATACCGGTTTTAGCCGGTGCTGTGACAATGCTGTTAACCGATCAGTATTTTGGCACCAGCTTTTTCAATGCAGCAGGCGGCGGTGATCCGGTTCTGTTTCAACACATATTCNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Travisia forbesii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!