Overview
Brief Summary
Biology
T. forbesii spawns from November to February. Eggs and larvae are non-pelagic. Like other Opheiiids, it is generaily considered to be a non-selective deposit feeder. T. forbesii is eaten by different kinds of fish (Wolff, 1973; Fauchald & Jumars, 1979; Hayward & Ryland, 1990).
-
Holtmann, S.E.; Groenewold, A.; Schrader, K.H.M.; Asjes, J.; Craeymeersch, J.A.; Duineveld, G.C.A.; van Bostelen, A.J.; van der Meer, J. (1996). Atlas of the zoobenthos of the Dutch continental shelf. Ministry of Transport, Public Works and Water Management: Rijswijk, The Netherlands. ISBN 90-369-4301-9. 243 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=83
Trusted
Distribution
Beaufort Sea, Belgian Exclusive Economic Zone, Canadian part of the Arctic Ocean, Dutch Exclusive Economic Zone, European waters (ERMS scope), Golfe Normanno-Breton, Gulf of St. Lawrence, Irish Exclusive economic Zone, Manicouagan, North East Atlantic, North West Atlantic, Portuguese Exclusive Economic Zone, Roscoff, Saint Lawrence River, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
-
Müller, Y. (2004). Faune et flore du littoral du Nord, du Pas-de-Calais et de la Belgique: inventaire. [Coastal fauna and flora of the Nord, Pas-de-Calais and Belgium: inventory]. Commission Régionale de Biologie Région Nord Pas-de-Calais: France. 307 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9269
-
Hayward, P.J.; Ryland, J.S. (Ed.) (1990). The marine fauna of the British Isles and North-West Europe: 1. Introduction and protozoans to arthropods. Clarendon Press: Oxford, UK. ISBN 0-19-857356-1. 627 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
-
Holtmann, S.E.; Groenewold, A.; Schrader, K.H.M.; Asjes, J.; Craeymeersch, J.A.; Duineveld, G.C.A.; van Bostelen, A.J.; van der Meer, J. (1996). Atlas of the zoobenthos of the Dutch continental shelf. Ministry of Transport, Public Works and Water Management: Rijswijk, The Netherlands. ISBN 90-369-4301-9. 243 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=83
-
Dauvin, J.-C.; Dewarumez, J.-M.; Gentil, F. (2003). Liste actualisée des espèces d’Annélides Polychètes présentes en Manche [An up to date list of polychaetous annelids from the English Channel]. Cah. Biol. Mar. 44(1): 67-95
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1138
-
Bellan, G. (2001). Polychaeta, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 214-231
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1429
-
ILVO macrofauna data: macrofauna monitoring on the Belgian Part of the North Sea since 1979
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=132965
-
ILVO epifauna en demersale visdata: epifauna en demersale vismonitoring op het Belgisch deel van de Noordzee sinds 1979
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=132964
-
Cattrijsse, A.; Vincx, M. (2001). Biodiversity of the benthos and the avifauna of the Belgian coastal waters: summary of data collected between 1970 and 1998. Sustainable Management of the North Sea. Federal Office for Scientific, Technical and Cultural Affairs: Brussel, Belgium. 48 pp.
http://www.marinespecies.org/mollusca/aphia.php?p=sourcedetails&id=61
-
MEDIN (2011). UK checklist of marine species derived from the applications Marine Recorder and UNICORN, version 1.0.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=149081
-
Guiry, M.D. & Guiry, G.M. (2011). Species.ie version 1.0 World-wide electronic publication, National University of Ireland, Galway (version of 15 March 2010).
http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=149068
-
Ramos, M. (ed.). 2010. IBERFAUNA. The Iberian Fauna Databank
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=149024
-
Miller, Roberta. 2011. The St. Anne de Bellevue Arctic Biological Station Collection In Museum collection database, Fisheries and Oceans Canada digital collections, Maurice Lamontagne Institute, Quebec
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=150285
-
Mark, S., Provencher, L., Albert, E. et Nozères, C. 2010. Cadre de suivi écologique de la zone de protection marine Manicouagan (Québec) : bilan des connaissances et identification des composantes écologiques à suivre. Rapp. tech. can. sci. halieut. aquat. 2914 : xi + 121 p
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=150858
-
Miller, Roberta. 2012. The museum collection database, Fisheries and Oceans Canada digital collections, Maurice Lamontagne Institute, Quebec
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=163928
Trusted
The distribution of T. forbesii comprises the subtidal zone in the western Wadden Sea, the Southern Bight and sorne locations in the Voordelta. Some individuals have been found at the Cleaver Bank, the Dogger Bank and in the north-eastern part of the area.
-
Holtmann, S.E.; Groenewold, A.; Schrader, K.H.M.; Asjes, J.; Craeymeersch, J.A.; Duineveld, G.C.A.; van Bostelen, A.J.; van der Meer, J. (1996). Atlas of the zoobenthos of the Dutch continental shelf. Ministry of Transport, Public Works and Water Management: Rijswijk, The Netherlands. ISBN 90-369-4301-9. 243 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=83
Trusted
southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: eastern Bradelle Valley), Magdalen Islands (from eastern Bradelle valley to the west, as far as Cape North, including the Cape Breton Channel); lower North Shore
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Physical Description
Diagnostic Description
Morphology
Like Ophelia borealis, T. forbesii is a short, spindle-shaped worm with a conical head, circular in cross section anteriorly, but without a clear ventral groove in the hind part. The body is made up of 30 segments and rneasures about 30 mm in length and 7 mm in width. Parapodia are inconspicuous, but finger-like gills are present from the second segment onwards. T. forbesii is whitish or flesh pink in colour and may be encrusted with sand. This species gives of a strong garlic-like smell when collected (Hartmann-Schröder, 1971; Hayward & Ryland, 1990).
-
Holtmann, S.E.; Groenewold, A.; Schrader, K.H.M.; Asjes, J.; Craeymeersch, J.A.; Duineveld, G.C.A.; van Bostelen, A.J.; van der Meer, J. (1996). Atlas of the zoobenthos of the Dutch continental shelf. Ministry of Transport, Public Works and Water Management: Rijswijk, The Netherlands. ISBN 90-369-4301-9. 243 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=83
Trusted
Ecology
Habitat
The species has been mainly found in medium to coarse sand with a very low silt content. T. forbesii is reported as a species inhabiting coarse to fine sand, and (rarely) mud (Hartmann- Schröder, 1971; Wolff, 1973; Hayward & Ryland, 1990).
-
Holtmann, S.E.; Groenewold, A.; Schrader, K.H.M.; Asjes, J.; Craeymeersch, J.A.; Duineveld, G.C.A.; van Bostelen, A.J.; van der Meer, J. (1996). Atlas of the zoobenthos of the Dutch continental shelf. Ministry of Transport, Public Works and Water Management: Rijswijk, The Netherlands. ISBN 90-369-4301-9. 243 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=83
Trusted
intertidal and infralittoral of the Gulf and estuary
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Depth range based on 312 specimens in 1 taxon.
Water temperature and chemistry ranges based on 197 samples.
Environmental ranges
Depth range (m): 0 - 184
Temperature range (°C): 0.606 - 17.229
Nitrate (umol/L): 1.508 - 16.736
Salinity (PPS): 10.036 - 35.574
Oxygen (ml/l): 3.996 - 7.537
Phosphate (umol/l): 0.091 - 1.503
Silicate (umol/l): 2.052 - 24.216
Graphical representation
Depth range (m): 0 - 184
Temperature range (°C): 0.606 - 17.229
Nitrate (umol/L): 1.508 - 16.736
Salinity (PPS): 10.036 - 35.574
Oxygen (ml/l): 3.996 - 7.537
Phosphate (umol/l): 0.091 - 1.503
Silicate (umol/l): 2.052 - 24.216
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 197 samples.
Environmental ranges
Depth range (m): 0 - 184
Temperature range (°C): 0.606 - 17.229
Nitrate (umol/L): 1.508 - 16.736
Salinity (PPS): 10.036 - 35.574
Oxygen (ml/l): 3.996 - 7.537
Phosphate (umol/l): 0.091 - 1.503
Silicate (umol/l): 2.052 - 24.216
Graphical representation
Depth range (m): 0 - 184
Temperature range (°C): 0.606 - 17.229
Nitrate (umol/L): 1.508 - 16.736
Salinity (PPS): 10.036 - 35.574
Oxygen (ml/l): 3.996 - 7.537
Phosphate (umol/l): 0.091 - 1.503
Silicate (umol/l): 2.052 - 24.216
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Travisia forbesii
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GGCACCATGTATCTGGTCGTTGCTCTTGTCATGTTTTTCGTTGCAGGGGCAATGGCGCTGTTGATTCGTCTGGAGCTATTCCAGCCCGGCTTGCAGTTCATCCGGCCTGATCTCTACAACGGGTTAATTACCATGCATGGGCTTGCCATGGTATTTGGCGTTGTGATGCCAGCGATGACAGGC---CTTGCCAATTGGCTGGTGCCGATGATGCTGGGCGCACCAGATATGGCGCTGCCAAGGGTGAACAACTGGGGTTTTTGGTTGTTGCCGCTTGGGCTGGGCATATTAGTGGCCACGATGTTCATGCCAGGCGGTGGACCGGCCAGTGGCTGGACGATGTACCCGCCACTTATGTTGCAAACA------GGCTTTTCTTTTCCGTTTATTATTTTTGCGGTGCATATTCTGGGCATCTCTTCGGTCATGGGCGGCATTAATGTGGCGGCCACGATTTTTAACATGCGTGCCCCAGGGCTTACCTTGATGCGCATGCCGTTATTTGTTTGGACATGGCTCATCACGGCGTTTCTTATTATTACGGCGATACCGGTTTTAGCCGGTGCTGTGACAATGCTGTTAACCGATCAGTATTTTGGCACCAGCTTTTTCAATGCAGCAGGCGGCGGTGATCCGGTTCTGTTTCAACACATATTCNN
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Travisia forbesii
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
