Overview

Comprehensive Description

Description

 Serpula vermicularis is a slender, tube-dwelling polychaete between 5 and 7 cm in length with about 200 segments. The tubes are cylindrical with occasional rings and irregular lengthwise ridges cut into blunt teeth. The operculum is calcareous and funnel shaped with radial grooves and a serrated circumference. The colour of the body of the worm varies from pale yellow to brick red. The tube is pinkish-white and the operculum is patterned with red and white rays.The tube is attached to hard substrata at the base but in reef aggregations is often free for much of its length.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology/Natural History: This species has two white calcium sacs near the midventral line on the posterior end of the peristomium. The sacs store calcium from a pair of glands which open on the "ventral shields" which are wide glandular pads on the ventral side of the anterior thoracic segments. The ventral shields probably secrete organic material and use this, combined with the calcium, to form a paste from which the tube is made. The tube appears to be shaped by the ventral shields and by a collar which is just behind the head. The tubes are made of both calcite and aragonite. The operculum is cartilaginous and secretes mucus, which seems to be both antibiotic and prevents fouling. The blood of this species, as with most species of serpulids and sabellids, contains chlorocruorin. Chlorocruorin has a very strong affinity for carbon monoxide--570 times as much as human hemoglobin has. This may partly explain why this worm may settle on some seaweed such as Fucus but seems to avoid Nereocystis. The pneumocysts of Nereocystis are inflated with carbon monoxide, which would probably be strongly toxic to these worms. The circulatory system of this species is unusual. It has a ventral blood vessel which moves blood posteriorly, but blood moves anteriorly through a sinus that surrounds the gut. Blood flow into peripheral parts is tidal.

The animal is a filter feeder. Predators include Pisaster ochraceous. Sexes are separate. Eggs and sperm are released into the water.

This is the "type species" for genus Serpula and Family Serpulidae. Note that it was originally described by Linnaeus. Serpulids feed by extending featherlike radioles, which also function as gills. The blood circulation within the radiole is unusual. Instead of having one-way flow through afferent and efferent vessels within the radiole, there is a single branchial vessel which blood flows in and out of. Serpulids possess giant nerve fibers running down their body which allows them to retract rapidly into their tube if disturbed.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Serpulids live in calcareous tubes, which often curve but are not strongly spiraled except perhaps in their earliest portion (photo). Their anterior appendages include a crown of featherlike radioles (photo) which protrude from the peristomium. Often the tube is sealed with an operculum (which is a modified radiole--photo) when the animal retreats inside. Most segments are wider than long. The thoracic region has more than 4 setigers. This species has a well-developed, funnel-shaped operculum (photo). The operculum has a ringlike thickening but no obvious protuberances just below the funnel. The radioles are red, pink, or orange and are usually banded with white. There are usually about 40 radioles in an adult. The operculum is shaped like a circular funnel and has up to 160 creases along its margin. The operculum is usually red. Sometimes the animal has more than one operculum. The white tube can be up to 20 cm long but is usually smaller. The tube is smooth or has longitudinal ridges, but no keel. The animal's body is yellow and up to 8 cm long. It has two eyes on the peristomium but none on the radioles. The animal has 7 thoracic segments and the abdomen has up to 190 segments.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: eastern Bradelle Valley); Magdalen Islands (from Eastern Bradelle valley to the west, as far as Cape North, including the Cape Breton Channel)
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographical Range: Cosmopollitan: Pacific, Atlantic, and Indian oceans, Mediterranean Sea, North Sea. Alaska to Baja California on our coast. Although this species occurs in Europe, it is not found on the east coast of the United States.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: This very common species is the only local serpulid with the reddish plumes and a funnel-shaped, symmetrical operculum with no protuberances. It is also the only species of large serpulid found in our area. Spirorbids are small and have a strongly coiled tube.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

infralittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 165 specimens in 1 taxon.
Water temperature and chemistry ranges based on 117 samples.

Environmental ranges
  Depth range (m): 0 - 25000
  Temperature range (°C): 7.254 - 27.099
  Nitrate (umol/L): 0.086 - 7.121
  Salinity (PPS): 31.235 - 38.993
  Oxygen (ml/l): 4.343 - 6.794
  Phosphate (umol/l): 0.085 - 1.030
  Silicate (umol/l): 1.247 - 20.289

Graphical representation

Depth range (m): 0 - 25000

Temperature range (°C): 7.254 - 27.099

Nitrate (umol/L): 0.086 - 7.121

Salinity (PPS): 31.235 - 38.993

Oxygen (ml/l): 4.343 - 6.794

Phosphate (umol/l): 0.085 - 1.030

Silicate (umol/l): 1.247 - 20.289
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 The calcareous tubes of Serpula vermicularis can be found attached to hard substrata such as rocks, stones, bivalve shells and ship hull's from low water to the sublittoral in depths up to 250 m. In some very sheltered areas the tubes aggregate together to form small reefs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth Range: Intertidal to 100 m

Habitat: Attached to the undersides of rocks in the intertidal, on floats, or on any surface of subtidal rocks.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Serpula vermicularis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGTTCGCTTTACCTCATATTCTCTTTAATCATGTTTTTGATTGGTGGAGCAATGGCGATGGTCATCCGGGCTGAATTATTTCAGCCAGGATTGCAATTAGTTGAACCTGACTTTTTTAATCAGATGACTACAGTACATGGCCTGATAATGGTTTTTGGTGCTGTTATGCCGGCATTTACAGGT---TTAGCTAATTGGATGGTGCCGATGATGATTGGTGCGCCTGATATGGCATTACCTAGAATGAACAACTGGAGTTTTTGGATTTTACCTTTTGCATTTTCAATCTTACTGATGTCGCTATTTATGGAAGGTGGTGGGCCTAATTTTGGTTGGACTTTTTATGCACCGCTTTCGACTACGTACAGTAACGATAGTACT---GCATTTTTTGTGTTTGCAGTACACATTATGGGTATCAGCTCAATAATGGGTGCAATTAACGTCATTGTTACTATCGTCAATTTAAGAGCGCCGGGAATGACCTGGATGAAACTGCCGCTATTTGTTTGGACTTGGTTGATAACAGCTTTTCTGTTGATAGCTGTGATGCCAGTTTTAGCGGGTGTTGTTACTATGGTATTAACAGATAAATATTTTGGTACGAGCTTTTTCAATGCCATGGGTGGTGGCGATCCTGTGATGTTCCAGCATATTTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Serpula vermicularis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Serpula vermicularis

Serpula vermicularis, known by common names including the calcareous tubeworm, fan worm, plume worm or red tube worm, is a species of segmented marine polychaete worm in the family Serpulidae. It is the type species of the genus Serpula and was first described by Linnaeus in 1767. It lives in a tube into which it can retract.[2]

Description[edit]

Calcareous tubes of S. vermicularis

Serpula vermicularis lives in a calcareous tube which is attached to a rock, boulder or other hard surface. The tube is often curved, but is not tightly coiled as in some other related species. It can grow to a length of 20 cm (7.9 in), but is usually shorter than this. The anterior part of the worm protrudes from the tube and has a plume of about 40 feather-like radioles projecting from the second segment, or peristomium, which also houses the two eyes and the mouth. The radioles are bipinnate and covered with fine cilia. They are commonly red, orange or pink and are usually banded with white. A funnel-shaped lid or operculum covers the entrance to the tube when the animal retracts inside. This lid has up to 160 fine creases around its edge and is symmetrical and usually red. It is sometimes divided into two. The yellow-coloured body has seven thoracic segments and up to 190 abdominal segments which are protected by the tube. At least four segments with setae (bristles) are found in the thoracic region.[2]

Distribution[edit]

Serpula vermicularis is cosmopolitan in distribution. It is found in the Pacific and Indian Oceans and the European seaboard of the Atlantic Ocean, but not on the North American coast. It occurs in the intertidal zone and at depths down to 100 m (330 ft).[2] Also along Southern African coast from Olifant's River to Maputo.[3]

Habitat[edit]

Serpula vermicularis grows on hard substrates. It favours shells of bivalves, boulders and man-made structures. Around the United Kingdom, juveniles were found to be plentiful growing on the bryozoan, Flustra foliacea. Large colonies sometimes form, but these are seldom on rocks. Larvae may settle on the tubes of other worms and their subsequent development can form reefs. These reefs are very fragile and often break up. This is sometimes due to the activity of certain boring sponges, such as Cliona celata (red boring sponge).[4]

Biology[edit]

The tube of S. vermicularis is made from calcite and aragonite. Calcium for its manufacture is stored in two white sacs on the ventral side of the peristomium. The tube is fabricated by the glandular ventral shields on the other thoracic segments, where calcium is mixed with an organic secretion to make a paste. This is formed into shape by a collar found just behind the first segment, the prostomium.[2]

Serpula vermicularis is a filter feeder and extends its radioles to catch phytoplankton and detritus. The radioles also act as gills. Blood is pumped in and out of these with the flow direction alternating in a single set of vessels. The blood is then pumped through a ventral blood vessel to the tip of the abdomen before returning through a sinus adjoining the gut.[2]

The blood of S. vermicularis contains the oxygen-binding pigment chlorocruorin. As well as transporting oxygen to the tissues, this binds carbon monoxide much more efficiently than does human haemoglobin. This may be the reason why the worm may settle and grow on brown seaweeds such as Fucus, but avoids giant kelp, Nereocystis. The latter uses carbon monoxide to inflate its pneumocysts, and this would be toxic to the worm.[2]

Life cycle[edit]

In the United Kingdom, spawning takes place between June and September. The larvae form part of the plankton for up to two months before settling on the seabed. Growth is fairly rapid with tubes extending by 1 cm (0.4 in) in a month. The worms mature in about 10 months and may live for several years.[4]

Ecology[edit]

Coldwater reefs built up by S. vermicularis take many years to develop and provide a hard substrate which other organisms use. The reefs around the United Kingdom support a diverse community of sessile invertebrates, including sponges, hydroids, ascidians, bryozoans, the worm Pomatoceros triqueter, the sea anemone Metridium senile and bivalves such as Chlamys spp., Modiolus modiolus and queen scallop, Aequipecten opercularis. Macrofauna include crabs such as Cancer pagurus, the sea urchins Echinus esculentus and Psammechinus miliaris, the brittle star Ophiothrix fragilis, the starfish Asterias rubens and the whelk Buccinum undatum. Red algae grow on the reef in shallow water. The tunicate Pyura microcosmus occurs on these reefs, but is seldom seen in other habitats. A large number of cryptic species of microfauna shelter among the tubes.[4]

Predators of the worm include sea urchins, starfish, and the wrasses Crenilabrus melops and Ctenolabrus rupestris.[4]

References[edit]

  1. ^ a b Serpula vermicularis Linnaeus, 1767 World Register of Marine Species. Retrieved 2011-10-30.
  2. ^ a b c d e f Serpula vermicularis Linnaeus, 1767 Walla Walla University. Retrieved 2011-10-30.
  3. ^ Branch, G.M., Branch, M.L, Griffiths, C.L. and Beckley, L.E. (2010). Two Oceans: a guide to the marine life of southern Africa Struik Nature, Cape Town. ISBN 978 1 77007 772 0
  4. ^ a b c d Biogenic Reefs UK Marine SAC's Project. Retrieved 2011-11-01.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!