Overview

Distribution

Atlantic Europe, Belgian Exclusive Economic Zone, Canary Islands, Caribbean Sea, Colombia, De Panne, European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Irish Exclusive economic Zone, Mediterranean Sea, Morocco, North Coast of Norway, North East Atlantic, North West Atlantic, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, West Africa, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Less common on North Sea
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Greenland to off Florida
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 17 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9 samples.

Environmental ranges
  Depth range (m): 0 - 341
  Temperature range (°C): 4.995 - 17.258
  Nitrate (umol/L): 1.331 - 12.326
  Salinity (PPS): 33.843 - 36.306
  Oxygen (ml/l): 3.977 - 6.717
  Phosphate (umol/l): 0.123 - 0.813
  Silicate (umol/l): 1.158 - 6.928

Graphical representation

Depth range (m): 0 - 341

Temperature range (°C): 4.995 - 17.258

Nitrate (umol/L): 1.331 - 12.326

Salinity (PPS): 33.843 - 36.306

Oxygen (ml/l): 3.977 - 6.717

Phosphate (umol/l): 0.123 - 0.813

Silicate (umol/l): 1.158 - 6.928
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / parasite
adult of Capulus ungaricus parasitises mucus of Bivalvia

Animal / parasite
adult of Capulus ungaricus parasitises mucus of Pectinacea
Other: major host/prey

Animal / parasite
adult of Capulus ungaricus parasitises mucus of Turritella communis

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Capulus ungaricus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTATATATTTTATTTGGAATATGATCAGGATTAGTTGGAACTGCCTTAAGATTACTAATTCGGGCTGAATTAGGACAACCTGGGGCCCTTTTAGGGGAC---GATCAATTATATAATGTAATTGTTACTGCACATGCTTTTGTAATAATTTTTTTTTTAGTTATACCTATAATAATTGGTGGATTTGGGAACTGATTAGTTCCGCTTATATTGGGAGCTCCAGATATAGCTTTTCCTCGGCTAAATAATATAAGTTTTTGACTATTGCCTCCTTCATTATTATTACTATTATCTTCAGCCGCAGTAGAAAGGGGAGCAGGAACTGGGTGAACTGTATATCCTCCATTATCAGGCAACCTGGCTCATGCTGGCGGTTCTGTTGACTTGGCTATTTTTTCTCTCCATTTAGCAGGTGTATCATCTATTTTAGGAGCTGTAAATTTTATTACAACAATTATTAATATGCGATGACGTGGAATACAGCTTGAACGTCTTCCATTATTTGTGTGGTCAGTTAAAATTACAGCTATTTTATTGTTATTATCATTGCCAGTTTTAGCAGGAGCTATTACTATGCTTTTAACAGATCGAAATTTTAATACTGCTTTTTTTGACCCTGCTGGGGGAGGAGATCCTATCTTATATCAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Capulus ungaricus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Capulus ungaricus

Capulus ungaricus, common name the bonnet shell, is a species of medium-sized sea snail, a marine gastropod mollusk in the family Capulidae, the cap snails.[1]

Contents

Taxonomy

The original name of this species is Capulus ungaricus (Linnaeus, 1758).[1] Later on, a few authors (e.g. Jeffreys, 1865, Thorson, 1941, Ziegelmeier, 1966, Lindner, 1977) changed the name erroneously in Capulus hungaricus.[1] The correct date of publication is 1758 and not 1767 as Abbott (1974) and Lindner (1977) cited.[1]

Distribution

The distribution of Capulus ungaricus includes the sea off Greenland to off Florida.[1] Its is less common in the North Sea.[1]

Description

The maximum recorded shell length is 50 mm.[2]

Habitat

Minimum recorded depth is 1 m.[2] Maximum recorded depth is 838 m.[2] It is known also from seamounts and knolls.[1]

Feeding habits

It is a suspension feeder.[1]

References

This article incorporates CC-BY-SA-3.0 text from the reference [1]

  1. ^ a b c d e f g h i Gofas, S. (2010). Capulus ungaricus (Linnaeus, 1758). In: Bouchet, P.; Gofas, S.; Rosenberg, G. (2010) World Marine Mollusca database. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=138984 on 2011-01-13
  2. ^ a b c Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!