Overview

Distribution

Less common on North Sea
  • Hayward, P.J.; Ryland, J.S. (Ed.) (1990). The marine fauna of the British Isles and North-West Europe: 1. Introduction and protozoans to arthropods. Clarendon Press: Oxford, UK. ISBN 0-19-857356-1. 627 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Greenland to off Florida
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 17 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9 samples.

Environmental ranges
  Depth range (m): 0 - 341
  Temperature range (°C): 4.995 - 17.258
  Nitrate (umol/L): 1.331 - 12.326
  Salinity (PPS): 33.843 - 36.306
  Oxygen (ml/l): 3.977 - 6.717
  Phosphate (umol/l): 0.123 - 0.813
  Silicate (umol/l): 1.158 - 6.928

Graphical representation

Depth range (m): 0 - 341

Temperature range (°C): 4.995 - 17.258

Nitrate (umol/L): 1.331 - 12.326

Salinity (PPS): 33.843 - 36.306

Oxygen (ml/l): 3.977 - 6.717

Phosphate (umol/l): 0.123 - 0.813

Silicate (umol/l): 1.158 - 6.928
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / parasite
adult of Capulus ungaricus parasitises mucus of Bivalvia

Animal / parasite
adult of Capulus ungaricus parasitises mucus of Pectinacea
Other: major host/prey

Animal / parasite
adult of Capulus ungaricus parasitises mucus of Turritella communis

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Capulus ungaricus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTATATATTTTATTTGGAATATGATCAGGATTAGTTGGAACTGCCTTAAGATTACTAATTCGGGCTGAATTAGGACAACCTGGGGCCCTTTTAGGGGAC---GATCAATTATATAATGTAATTGTTACTGCACATGCTTTTGTAATAATTTTTTTTTTAGTTATACCTATAATAATTGGTGGATTTGGGAACTGATTAGTTCCGCTTATATTGGGAGCTCCAGATATAGCTTTTCCTCGGCTAAATAATATAAGTTTTTGACTATTGCCTCCTTCATTATTATTACTATTATCTTCAGCCGCAGTAGAAAGGGGAGCAGGAACTGGGTGAACTGTATATCCTCCATTATCAGGCAACCTGGCTCATGCTGGCGGTTCTGTTGACTTGGCTATTTTTTCTCTCCATTTAGCAGGTGTATCATCTATTTTAGGAGCTGTAAATTTTATTACAACAATTATTAATATGCGATGACGTGGAATACAGCTTGAACGTCTTCCATTATTTGTGTGGTCAGTTAAAATTACAGCTATTTTATTGTTATTATCATTGCCAGTTTTAGCAGGAGCTATTACTATGCTTTTAACAGATCGAAATTTTAATACTGCTTTTTTTGACCCTGCTGGGGGAGGAGATCCTATCTTATATCAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Capulus ungaricus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Capulus ungaricus

Capulus ungaricus, common name the bonnet shell, is a species of medium-sized sea snail, a marine gastropod mollusk in the family Capulidae, the cap snails.[1]

Contents

Taxonomy

The original name of this species is Capulus ungaricus (Linnaeus, 1758).[1] Later on, a few authors (e.g. Jeffreys, 1865, Thorson, 1941, Ziegelmeier, 1966, Lindner, 1977) changed the name erroneously in Capulus hungaricus.[1] The correct date of publication is 1758 and not 1767 as Abbott (1974) and Lindner (1977) cited.[1]

Distribution

The distribution of Capulus ungaricus includes the sea off Greenland to off Florida.[1] Its is less common in the North Sea.[1]

Description

The maximum recorded shell length is 50 mm.[2]

Habitat

Minimum recorded depth is 1 m.[2] Maximum recorded depth is 838 m.[2] It is known also from seamounts and knolls.[1]

Feeding habits

It is a suspension feeder.[1]

References

This article incorporates CC-BY-SA-3.0 text from the reference [1]

  1. ^ a b c d e f g h i Gofas, S. (2010). Capulus ungaricus (Linnaeus, 1758). In: Bouchet, P.; Gofas, S.; Rosenberg, G. (2010) World Marine Mollusca database. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=138984 on 2011-01-13
  2. ^ a b c Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!