Overview

Distribution

Greenland to Connecticut; Europe
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

intertidal and infralittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 6 specimens in 2 taxa.

Environmental ranges
  Depth range (m): 0 - 1

Graphical representation

Depth range (m): 0 - 1
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lacuna pallidula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTGGTATATGATCTGGTTTAGTTGGTACAGCACTAAGTTTGTTAATTCGAGCTGAATTAGGACAACCAGGAGCTTTACTAGGTGAC---GATCAATTATATAATGTAATTGTGACAGCTCATGCCTTTGTTATAATTTTTTTTTTGGTTATACCTATAATAATTGGTGGATTTGGTAATTGATTGGTTCCTTTAATATTAGGAGCACCTGATATAGCTTTTCCACGTTTAAATAATATAAGTTTCTGACTTTTACCTCCTGCTTTATTACTTTTACTATCTTCAGCCGCTGTAGAGAGGGGAGTTGGAACTGGATGGACAGTATATCCTCCTTTATCTGGAAATTTAGCACATGCAGGAGGTTCTGTAGATCTTGCTATCTTTTCATTACATTTAGCAGGTGTTTCTTCTATTTTAGGGGCTGTAAATTTTATTACTACGATTATTAATATACGATGACGAGGTATGCAATTTGAACGGCTTCCTTTATTTGTATGATCTGTAAAAATTACTGCTATTCTCTTACTTCTCTCTTTACCTGTTTTAGCCGGAGCTATTACTATGCTTTTAACTGATCGAAATTTTAATACGGCTTTCTTTGATCCTGCAGGAGGTGGAGAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lacuna pallidula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lacuna pallidula

Lacuna pallidula, common name the pale lacuna, is a species of sea snail, a marine gastropod mollusk in the family Littorinidae, the winkles or periwinkles.[1]

Distribution[edit source | edit]

Description[edit source | edit]

The maximum recorded shell length is 10 mm.[2]

Habitat[edit source | edit]

Minimum recorded depth is 0 m.[2] Maximum recorded depth is 70 m.[2]

References[edit source | edit]

  1. ^ a b Lacuna pallidula (da Costa, 1778). Gofas, S. (2009). Lacuna pallidula (da Costa, 1778). In: Bouchet, P.; Gofas, S.; Rosenberg, G. (2009) World Marine Mollusca database. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=140168 on 6 June 2010.
  2. ^ a b c Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!