Overview

Distribution

Range Description

This species is widely dispersed occurring from Japan to the Philippines with separate populations in New Caledonia and also the Dahlak Archipelago off the coast of Eritrea (Röckel et al. 1995).

The EOO, AOO and number of locations exceed the thresholds for criteria B1 and B2.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species has been found at depths between 50 and 420 m with the latter being recorded off the coast of New Caledonia. It probably lives in sand and/or mud. Adults may grow to 50 mm but will typically be less than this (Röckel et al. 1995).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 8 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 180 - 390
  Temperature range (°C): 14.043 - 20.287
  Nitrate (umol/L): 2.745 - 10.640
  Salinity (PPS): 35.151 - 35.655
  Oxygen (ml/l): 4.208 - 4.481
  Phosphate (umol/l): 0.372 - 0.840
  Silicate (umol/l): 1.367 - 5.432

Graphical representation

Depth range (m): 180 - 390

Temperature range (°C): 14.043 - 20.287

Nitrate (umol/L): 2.745 - 10.640

Salinity (PPS): 35.151 - 35.655

Oxygen (ml/l): 4.208 - 4.481

Phosphate (umol/l): 0.372 - 0.840

Silicate (umol/l): 1.367 - 5.432
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Conus pagodus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AACACTTTATATTTTGTTTGGTATGTGATCCGGCTTGGTTGGTACTGCTTTAAGTCTTCTTATTCGTGCCGAATTAGGTCAACCAGGGGCCTTACTTGGTGATGATCAATTATATAATGTAATTGTAACTGCACACGCTTTTGTTATGATTTTTTTTCTTGTAATGCCAATGATAATTGGTGGCTTTGGAAACTGATTAGTTCCTTTAATGTTAGGAGCTCCTGATATAGTTTTTCCTCGCCTAAATAATATAAGATTTTGACTTTTACCTCCTGCACTTCTTTTACTTCTTTCTTCAGCCGCAGTAGAAGGTGGTGTAGGAACAGGATGGACTGTATATCCTCCATTAGCAGGGAATTTGGCTCATGCTGGAGGTTCAGTAGATTTGGCTATTTTTTCTTTACATCTTGCTGGGGTTTCTTCTATTTTAGGAGCAGCAAATTTTATTAGAACTATTATTAATATGCGATGACGGGCAGTAAAGTTTGAACGGCTATCACTTTTTGTATGATCAGTAAAAATTACGGCAATTTTACTTCTTTTATCACTGCCTGTCTTAGCTGGTGCGATTACAATACTTTTAACGGATCGAAATTTTAATACAACATTTTTTGATCCAGCAGGAGGTGGGGACCCTGTTTTGTATCAGCACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Conus pagodus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Duda, T.

Reviewer/s
Tagaro, S. & Peters, H.

Contributor/s

Justification
This species is widely dispersed occurring from Japan to the Philippines with separate populations in New Caledonia and also the Dahlak Archipelago off the coast of Eritrea. This species is uncommon in deepwater in the Philippines. There are no known major threats to this species. It is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is uncommon in deepwater in the Philippines (G.T. Poppe pers. comm. 2011).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no known major threats to this wide-ranging species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species would benefit from further research into populations, distribution, habitat, level of off-take and threats (including the impact of fisheries) before any action plan can be formulated. There are no known conservation measures currently in place for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Conus pagodus

Conus pagodus, common name the pagoda cone, is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[2]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

The size of an adult shell varies between 26 mm and 50 mm. The shell is pear-shaped, broad and angulated at the shoulder, contracted towards the base. The body whorl is closely sulcate throughout, with the sulci striate. The intervening ridges are rounded. The spire is carinate, concavely elevated, with an acute and striate apex. The color of the shell is whitish, obscurely doubly banded with clouds of light chestnut, and the spire maculated with the same. [3]

Distribution

This species is distributed in the Pacific Ocean along Japan, Vietnam, Philippines, New Caledonia.

References

  1. ^ Kiener, L. C., 1845. Spécies Général et Iconographie des Coquilles Vivantes, 2.
  2. ^ Conus pagodus Kiener, 1845.  Retrieved through: World Register of Marine Species on 4 August 2011.
  3. ^ George Washington Tryon, Manual of Conchology vol. VI, p. 74-75; 1884
  • Filmer R.M. (2001). A Catalogue of Nomenclature and Taxonomy in the Living Conidae 1758 - 1998. Backhuys Publishers, Leiden. 388pp
  • Tenorio M.J., Poppe G.T. & Tagaro S.P. (2007) New Indo-Pacific Conidae with taxonomic and nomenclatural notes on Conus recluzianus. Visaya 2(2): 78-90
  • Tucker J.K. (2009). Recent cone species database. September 4th 2009 Edition

Gallery

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!