Overview

Distribution

Range Description

This species occurs throughout the Indo-Pacific, ranging from the east coast of Africa to the Marshall Islands and New Caledonia. (Röckel et al. 1995). The EOO, AOO and number of locations exceed the thresholds for criteria B1 and B2.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found at depths from 2-280 m in sand and silt. Adults can grow up to a maximum size of 118 mm, although they will generally be smaller than this (Röckel et al. 1995). It is piscivorous in its diet. This is the only Conus for which the complete genome has been sequenced (G.T. Poppe pers. comm. 2011).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 24 - 67

Graphical representation

Depth range (m): 24 - 67
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Conus consors

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACCTTATATTTTCTATTTGGAATATGATCAGGACTAGTAGGGACTGCTTTAAGGTTGTTGATTCGTGCGGAATTAGGGCAGCCTGGTGCTTTGCTTGGGGACGATCAGTTATATAATGTAATTGTAACGGCGCATGCCTTTGTTATAATTTTCTTTTTAGTAATGCCTATGATGATTGGGGGGTTTGGAAATTGATTAGTACCTTTGATGTTAGGAGCTCCAGACATAGTATTTCCCCGTTTAAATAATATGAGTTTTTGGCTTCTTCCTCCTGCGCTTTTACTTCTTTTGTCTTCAGCTGCGGTGGAAAGGGGGGTAGGTACTGGATGGACTGTATATCCACCTCTTGCAGGAAATCTAGCTCATGCTGGTGGTTCTGTAGATCTTGCAATTTTTTCTTTGCATCTTGCTGGGGTATCTTCTATTTTAGGGGCTGTAAACTTTATTACCACAATTATTAATATGCGGTGACAAGGGATGAAATTTGAGCGTCTTTCATTATTTGTGTGATCAGTGAAGATCACGGCTATTTTACTTCTTTTGTCTTTACCTGTTTTGGCAGGAGCTATTACTATACTTTTGACTGATCGAAATTTCAACACTGCTTTCTTTGATCCGGCAGGAGGTGGTGATCCTATTTTGTATCAGCATCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Conus consors

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Kohn, A.

Reviewer/s
Peters, H. & Poppe, G.

Contributor/s

Justification
This species occurs throughout the Indo-Pacific, ranging from the east coast of Africa to the Marshall Islands and New Caledonia. This species is wide ranging in the Indo-Pacific and may be locally abundant. There are no known major threats, therefore it is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species may be locally abundant.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is widely distributed and there are currently no known threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures currently in place for this species. It probably occurs in many marine protected areas throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Conus consors

Conus consors, common name the singed cone, is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[2]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

The size of an adult shell varies between 33 mm and 118 mm. The depressed spire is conical, with a shallow channel and revolving striae, sometimes tessellated with chestnut. The body whorl is rather narrow, somewhat convex, grooved towards the base, somewhat round-shouldered, rather thin. The color of the shell is white, yellowish and orange-brown, variously clouded and indistinctly banded. The aperture is white. [3]

Distribution

This marine species occurs in the Indo-West Pacific Region to the Marshall Islands, in Melanesia and along Queensland, Australia.

References

  1. ^ Sowerby (ii), G. B. Jr., 1833. The Conchological Illustrations
  2. ^ a b Conus consors G. B. Sowerby II, 1833.  Retrieved through: World Register of Marine Species on 17 July 2011.
  3. ^ George Washington Tryon, Manual of Conchology, vol. VI, p 52; 1879
  • Filmer R.M. (2001). A Catalogue of Nomenclature and Taxonomy in the Living Conidae 1758 - 1998. Backhuys Publishers, Leiden. 388pp.
  • Tucker J.K. (2009). Recent cone species database. September 4th 2009 Edition
  • Tucker J.K. & Tenorio M.J. (2009) Systematic classification of Recent and fossil conoidean gastropods. Hackenheim: Conchbooks. 296 pp.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!