Overview

Distribution

Range Description

This species is found from southern Japan and Taiwan, in south Viet Nam, through the Philippines, Solomon Islands, and south to New Caledonia (P. Bouchet pers comm. 2011). It has a depth distribution of 80-400 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

This species live on coral rubble and muddy-sand soft bottom substrate, at depths ranging from 80 to 400 m. Adults of this species can grow to 50 mm although they will typically be less than this (Röckel et al. 1995).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 8 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 235 - 340
  Temperature range (°C): 17.400 - 17.969
  Nitrate (umol/L): 5.251 - 5.755
  Salinity (PPS): 35.458 - 35.557
  Oxygen (ml/l): 4.282 - 4.418
  Phosphate (umol/l): 0.505 - 0.574
  Silicate (umol/l): 2.657 - 2.821

Graphical representation

Depth range (m): 235 - 340

Temperature range (°C): 17.400 - 17.969

Nitrate (umol/L): 5.251 - 5.755

Salinity (PPS): 35.458 - 35.557

Oxygen (ml/l): 4.282 - 4.418

Phosphate (umol/l): 0.505 - 0.574

Silicate (umol/l): 2.657 - 2.821
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Conus comatosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AACACTTTATATTTTGTTTGGGATGTGATCTGGTTTGGTCGGTACTGCTTTGAGCCTTTTAATCCGTGCTGAGTTAGGTCAACCTGGAGCTTTGTTAGGTGATGATCAGTTATATAATGTAATTGTAACTGCTCATGCTTTCGTAATAATTTTTTTCCTTGTAATGCCAATGATAATTGGTGGCTTTGGGAATTGACTAGTTCCTTTAATATTAGGAGCTCCTGATATGGTTTTTCCCCGATTAAACAATATAAGATTTTGACTTTTACCTCCTGCGTTGCTTCTACTCTTATCTTCAGCTGCGGTTGAAGGTGGGGTTGGAACCGGATGGACTGTATATCCTCCATTGGCCGGAAATTTAGCTCATGCTGGAGGTTCTGTAGACTTGGCTATTTTTTCTCTTCATCTTGCAGGGGTTTCTTCTATTTTAGGAGCTGCAAACTTTATTAGGACTATTATCAATATGCGATGACAGGCAGTAAAGTTTGAACGGTTATCGCTTTTTGTGTGATCAGTAAAAATCACGGCAATTTTACTACTTTTATCTTTACCTGTATTAGCTGGTGCAATTACGATACTGCTAACAGATCGGAATTTTAATACCACATTTTTTGATCCAGCAGGAGGTGGAGATCCCGTCTTATATCAGCATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Conus comatosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Bouchet, P.

Reviewer/s
Seddon, M. & Peters, H.

Contributor/s

Justification

This species is found from southern Japan and Taiwan, south Viet Nam, the Philippines, Solomon Islands, and south to New Caledonia. Because of this species' wide range and depth distribution and lack of apparent threats, it is listed as Least Concern.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There are no data in the literature on populations. This species is common through most of its range and locally abundant in the Philippines.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no known threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures currently in place for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Conus comatosa

Conus comatosa is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[2]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Description[edit]

Distribution[edit]

This species occurs in the Pacific Ocean along Japan, the Philippines, Northwest Australia, New Caledonia and the Solomon Islands.

References[edit]

  1. ^ Pilsbry, H. A., 1904. New Japanese marine Mollusca: Gastropoda. Proceedings of the Academy of Natural Sciences of Philadelphia, 56
  2. ^ a b Conus comatosa Pilsbry, 1904.  Retrieved through: World Register of Marine Species on 17 July 2011.
  • Filmer R.M. (2001). A Catalogue of Nomenclature and Taxonomy in the Living Conidae 1758 - 1998. Backhuys Publishers, Leiden. 388pp
  • Tucker J.K. (2009). Recent cone species database. September 4th 2009 Edition
  • Puillandre N., Meyer C.P., Bouchet P. & Olivera B.M. (2011) Genetic divergence and geographic variation in the deep-water Conus orbignyi complex (Mollusca: Conoidea). Zoologica Scripta 40(4): 350-363.
  • Severns M. (2011) Shells of the Hawaiian Islands - The Sea Shells. Conchbooks, Hackenheim. 564 pp.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!