Overview

Distribution

Range Description

This species is found from Japan to the Philippines and Melanesia (this includes Papua New Guinea, Solomon Islands, New Caledonia and Vanuatu). It is also found in many locations in the Indian Ocean including Madagascar, Reunion, Somalia, India and Western Thailand, and probably also found in Indonesia (Röckel et al. 1995).

The EOO, AOO and locations exceed the thresholds for criteria B1 and B2.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occupies muddy ocean beds of depths between 10-250 m. Adults of this species are typically between 33-63 mm in length (Röckel et al. 1995).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 38 - 75
  Temperature range (°C): 25.857 - 27.590
  Nitrate (umol/L): 0.954 - 3.610
  Salinity (PPS): 34.202 - 34.451
  Oxygen (ml/l): 4.008 - 4.381
  Phosphate (umol/l): 0.177 - 0.392
  Silicate (umol/l): 2.202 - 4.097

Graphical representation

Depth range (m): 38 - 75

Temperature range (°C): 25.857 - 27.590

Nitrate (umol/L): 0.954 - 3.610

Salinity (PPS): 34.202 - 34.451

Oxygen (ml/l): 4.008 - 4.381

Phosphate (umol/l): 0.177 - 0.392

Silicate (umol/l): 2.202 - 4.097
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Conus praecellens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GACACTCTATATTCTATTCGGTATATGATCTGGGTTAGTTGGAACTGCACTAAGTTTGTTAATTCGTGCAGAATTGGGGCAACCAGGTGCTCTTCTTGGGGATGATCAGTTATATAATGTGATTGTAACAGCACATGCTTTTGTTATGATTTTTTTCCTAGTGATACCTATAATAATTGGAGGATTTGGAAATTGACTTGTGCCATTAATGTTAGGGGCACCAGATATAGTTTTTCCTCGGTTAAATAATATAAGTTTTTGGCTTCTTCCTCCTGCTCTTTTGCTTCTTCTGTCGTCAGCTGCTGTAGAAAGTGGGGTTGGTACAGGATGAACAGTATATCCACCCCTAGCAGGAAATTTAGCGCATGCAGGAGGTTCTGTAGATCTCGCTATTTTTTCTTTACATCTTGCTGGTGTATCTTCTATTTTAGGGGCAGTGAATTTTATTACTACAATTATCAATATACGATGACAGGGAATGAAGTTTGAGCGGCTTTCGTTATTTGTGTGATCGGTAAAAATTACAGCTATTTTACTTCTTTTATCTTTACCTGTGTTAGCGGGGGCAATTACAATGCTTTTAACTGATCGAAATTTTAATACTGCTTTTTTTGACCCCGCAGGAGGTGGAGATCCTATTTTATATCAACACTTGTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Conus praecellens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Duda, T.

Reviewer/s
Peters, H. & Tagaro, S.

Contributor/s

Justification
This species is found from Japan to the Philippines and Melanesia (this includes Papua New Guinea, Solomon Islands, New Caledonia and Vanuatu). It is also found in many locations in the Indian Ocean including Madagascar, Reunion, Somalia, India and Western Thailand, and probably also found in Indonesia. This species is very common in shallow and deep water. There are no known major threats to this species. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is very common in shallow and deep water (G. T. Poppe per. comm. 2011).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no known major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures currently in place for this species
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Conus praecellens

Conus praecellens, common name the admirable cone, is a species of sea snail, a marine gastropod mollusk in the family Conidae, the cone snails and their allies.[2]

Like all species within the genus Conus, these snails are predatory and venomous. They are capable of "stinging" humans, therefore live ones should be handled carefully or not at all.

Contents

Description

Apertural view of shell of Conus praecellens A. Adams, 1855,measuring 25.5 mm in height, trawled at 80 fms. off Aliguay Island, in the Philippines.

The size of an adult cone varies between 20 mm and 63 mm. The shell is pear-shaped, broad and angulated at the shoulder, contracted towards the base. The body whorl is closely sulcate throughout, the sulci striate The intervening ridges of the rounded spire are carinate, concavely elevated, The acute apex is striate. The color of the shell is whitish, obscurely doubly banded with clouds of light chestnut, and the spire is maculated with the same.[3]

This is a variable species, yet two distinct forms are recognized: (1) sowerbii form, Reeve, 1849 (a thicker, darker, and more densely spotted form with 2 protoconch whorls), and (2) aliguay form, Olivera & Biggs, 2010 (2.5 pearly white smooth protoconch whorls, more slender, higher spire, rounded shoulders, lighter colored).[4] The sowerbii form is the most common form, and until the late 1990s was the only form typically found and in private collections.

Distribution

This marine species has a wide distribution. It occurs in the Indian Ocean along Madagascar, Réunion, Somalia, India, West Thailand and Western Australia; in the Pacific Ocean from Japan to the Philippines and Melanesia (Papua New Guinea, Solomon Islands, New Caledonia, Vanuatu).

References

  1. ^ Adams, A., 1854. Descriptions of New Species of the Genus Conus, from the Collection of Hugh Cuming, Esq.. Proceedings of the Zoological Society of London, 1854: 116 -119
  2. ^ a b Conus praecellens A. Adams, 1855.  Retrieved through: World Register of Marine Species on 5 August 2011.
  3. ^ George Washington Tryon, Manual of Conchology vol. VI p. 74-75; 1884 (described as Conus cancellatus)
  4. ^ Biggs, J. S., Watkins, M. Showers Corneli, P. and Olivera, B. M. (2010). Defining a clade by morphological, molecular, and toxinological criteria: distinctive forms related to Conus praecellens A. Adams, 1854 (Gastropoda: Conidae). Nautilus 124:1-19.
  • Filmer R.M. (2001). A Catalogue of Nomenclature and Taxonomy in the Living Conidae 1758 - 1998. Backhuys Publishers, Leiden. 388pp.
  • Tucker J.K. (2009). Recent cone species database. September 4, 2009 Edition
  • Tucker J.K. & Tenorio M.J. (2009) Systematic classification of Recent and fossil conoidean gastropods. Hackenheim: Conchbooks. 296 pp

Gallery

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!