Overview

Brief Summary

Acanthocephalans (thorny-headed worms, phylum Acanthocephala) are obligate endoparasites (i.e., internal parasites), ranging in size from 1 mm to over 40 cm, with a two-host life cycle involving arthropods and vertebrates. Cases of acanthocephaliasis in humans (which are not very common as far as is known) generally occur in areas where insects are eaten for dietary or medicinal purposes. Nearly all known cases in humans have involved infection of the gastrointestinal tract, although Haustein et al. (2009) reported removing an immature unidentified acanthocephalan from a patient's eye.

Moniliformis moniliformis is one of the two main acanthocephalans known to infect humans and cause acanthocephaliasis (the other being Macracanthorhynchus hirudinaceus). The definitive host for M. moniliformis (i.e., the host in which the parasite reaches maturity) is typically a rat, although carnivores and primates, including humans, may serve as accidental hosts. The parasite's eggs are ingested by an intermediate host (typically a beetle or cockroach), which is subsequently eaten by the definitive host, resulting in infection of the definitive host. In infected human hosts, the worms seldom mature or mature but do not produce eggs.

(Source: Centers for Disease Control Parasites and Health website)

Libersat and Moore (2000) found that cockroaches (Periplaneta americana) infected by M. moniliformis showed reduced predator avoidance behavior, a phenomenon that presumably benefits the parasite by increasing the likelihood that its cockroach host will be ingested by a rodent, a necessary event for the parasite to complete its life cycle.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Moniliformis moniliformis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATCCTGTATATATTATCTGCTGTATGAGGGGGTATGATAGGGTTAATAATGAGTGTAATCATTCGTTTGGAGCTAGGGAGTGTGGGTAGACTTTTGGTGGAT---AATCATCTTTACAATGTAGTAGTAAGATCTCATGCTATTTTGATGATTTTCTTTTTAGTCATGCCTATTACTATAGGGGGGTTTGGAAACTGAATAGTTCCCATCATGTTAGGAGTGGGTGATATAGCTTTTCCACGTATAAATAATTTTAGGTTTTGGCTCCTTCCAGCATCATTGGCGGTTTTTTTAGCATCTTTGCTTATTGACGGG---GCTGCTACAGGATGGACTTTGTATCCTCCCCTAAGGTCCTATGGGTTTAGCAGGGGGATTTCTGTTGATCTAATGATCTTGTCCCTCCATGTAGCCGGATTGTCATCTATTTTAGCTTCTATTAATATAATATCTACAGTATGGGGGGTAAAAGAGATGGGGGTGAGTGTTGAGAAGTTAACTTTATTTGTATGATCATTGCTTGTTACCTCAGGTTTAGTCCTTGTGACAATACCTGTGCTAGCAGCTGCTCTGACGATGCTTTTATTGGATCGTAACTTAATAACAACTTTTTTTGATCCAGCTGGTGGGGGGAGGGCGATTATATTTCAGCATCTGTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Moniliformis moniliformis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Moniliformis moniliformis is one of the two main acanthocephalans known to infect humans and cause acanthocephaliasis (the other being Macracanthorhynchus hirudinaceus). The definitive host for M. moniliformis (i.e., the host in which the parasite reaches maturity) is typically a rat, although carnivores and primates, including humans, may serve as accidental hosts. The parasite's eggs are ingested by an intermediate host (typically a beetle or cockroach), which is subsequently eaten by the definitive host, resulting in infection of the definitive host. In infected human hosts, the worms seldom mature or mature but do not produce eggs.

(Source: Centers for Disease Control Parasites and Health website)

Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Moniliformis moniliformis

Moniliformis moniliformis is a parasite of the Acanthocephala phylum in the family Moniliformidae. Along with Macrocanthorhynchus hirudinaceous, M. moniliformis is an acanthocephalan worm species that can infect humans, though rare.

The earliest known human infection was found in Utah in the coprolite of a prehistoric man. Specimen analysis showed a significant amount of M. moniliformis eggs in the coprolite.[1] In 1888 in Italy, Calandruccio infected himself by ingesting larvae, reported gastrointestinal disturbances, and then shed the eggs in two weeks. This was the first report of the clinical manifestations of an M. moniliformis infection in humans.

Distribution[edit]

Infected rats have been found world-wide. Cases of human infection by Moniliformis moniliformis have been reported in the United States, Iran, Iraq, and Nigeria.[2]

Morphology[edit]

Acanthocephalans do not have digestive tracts and absorb nutrients through the tegument, the external layer. The scolex of this worm has a cylindrical proboscis and a multitude of curved hooks. The main parts of the worm body are the proboscis, neck, and trunk. Because of horizontal markings on the worm, there is the appearance of segmentation. Acanthocephalans are sexually dimoprhic- adult males are generally 4 to 5 cm long while females are longer, ranging from lengths of 10 to 30 cm. Males also have copulatory bursas, used to hold on to the female during copulation and cement glands. Females have floating ovaries within a ligament sac where fertilization of the eggs occurs.[3] The eggs of this parasite are 90-125 μm long and 65 μm wide. They are oval in shape with a thick, clear outer coat.[4]

Reservoirs[edit]

While acanthocephalans rarely infect humans, there have been several cases reported of M. moniliformis causing acanthocephaliasis in humans as their definitive hosts. Usually, the definitive hosts for M. moniliformis are rodents, cats, dogs and red foxes (in Poland). The intermediate hosts are usually beetles and cockroaches.[2][5]

Vectors[edit]

No known vectors

Life cycle[edit]

In the life cycle of M. moniliformis, the intermediate hosts ingest the eggs of the parasite. In the intermediate host, the acanthor, or the parasite in its first larval stage, morphs into the acanthella, the second larval stage. After 6–12 weeks in this stage, the acanthella becomes a cystacanth. The cystacanth, or infective acanthella, of M. moniliformis are cyst-shaped and encyst in the tissues of the intermediate hosts. However, most other acanthocephalans have infective larvae that more closely resemble underdeveloped adult worms. The definitive hosts consume the cystacanths upon feeding on infected intermediate hosts. These cystacanths mature and mate in the small intestine in 8–12 weeks. After this time, the eggs are excreted with the feces, to be ingested yet again by another intermediate host and renew this cycle.[4]

Reproduction of the parasite only occurs in the definitive host. In acanthocephalans, adult males have cement glands in their posterior ends. The widely held theory is that the mucilaginous and proteinaceous substance that these glands secrete is used by males to seal up the females after copulation in order to prevent leakage of the inseminated sperm and further insemination by other males. It has also been found that these males may create this seal on other males in order to prevent them from copulating.[6] These seals, or copulatory caps, last for a week.

Behavioral changes in the intermediate host[edit]

In what is commonly known as "brain-jacking," the parasite induces a behavioral change in its intermediate host that increases the risk of predation for the host. It is thought that this behavioral change holds an evolutionary advantage for the parasite by increasing its chances of getting to its definitive host. When Moniliformis moniliformis infects its intermediate host, the cockroach species, Periplaneta americana it changes the cockroach's escape response. In one study, it was concluded that cockroaches infected by M. moniliformis took longer to respond to wind stimuli simulating the approach of a potential predator and displayed fewer escape responses implying that the parasite infection renders its intermediate host more vulnerable to predation by hindering its ability to detect and escape from its predator. It is thought that serotonin plays a role in upending the communication between giant interneurons and the thoracic interneurons and in turn hampers the escape response of the cockroach.[7] In a similar study, the effects of parasitism on 3 Periplaneta species are studied. The results show that Periplaneta australasiae uses substrates differently and moves around less when infected with Moniliformis moniliformis.[8] Another study concludes an increased vulnerability of infected Periplaneta americana due to increased phototaxis, more time spent moving (due to slower movement) and movement in response to light (uninfected cockroaches hesitated before moving).[9]

Human infection[edit]

Infection of a definitive host is called acanthocephaliasis. Because infection of humans would require human consumption of infected raw beetles or cockroaches, human acanthocephaliasis is rare.

Clinical manifestations[edit]

Calandruccio provided the first description of the clinical manifestations of acanthocephaliasis and similar accounts are found in the case studies since. There are not many case studies on acanthocephaliasis but of the ones that exist, many of the patients described were asymptomatic. When the patients exhibited symptoms, they normally experienced abdominal pain, diarrhea, dizziness, edema, and anorexia.[10] In some patients, giddiness has also been reported.[2] In rodents, acanthocephaliasis is fatal and manifests itself through similar hemorrhaging and gastrointestinal disturbance.

Diagnosis[edit]

The proper diagnosis of acanthocephaliasis in humans is made through fecal analysis, which if the host is infected should contain adult worms or eggs. To obtain the worms from the host, piperazine citrate, tetramisole and bithionol can be administered to the patient.[10]

Treatment[edit]

Acanthocephaliasis is treated with anti-helminthics. There is considerable debate over the efficacy of anti-helminth drugs on this parasite, but thus far, the drugs seem to be working. Pyrantel pamoate has been shown to be particularly effective in treating patients, as has ivermectin.[10] Mebendazole and thiabendazole have also both been cited to work.[11][12]

Prevention strategies[edit]

Because the only way of developing acanthocephaliasis is through ingesting the intermediate hosts, the most effective means of prevention is avoiding the consumption of beetles and cockroaches. This is especially difficult in children exhibiting pica and in areas with poor hygiene. Awareness campaigns on the risks of consuming infected beetles and cockroaches would be effective. Moreover, preventing entry of the intermediate hosts into the home, and especially the kitchen where it is at risk of getting into the food, would help curb the risk of becoming infected.[13]

References[edit]

  1. ^ [1], Moore, JG, Fry, GF, Englert, EJR. Thorny-headed worm infection in North American prehistoric man. Science 1969; 1324–1325.
  2. ^ a b c [2], "Acanthocephalan Worms." Gideon. Gideon Informatics. Web.
  3. ^ [3], "Phylum: Acanthocephala." Lecture. Animal Parasitology. Kansas State, 14 March 2005. Web. 23 February 2010.
  4. ^ a b [4], Acanthocephaliasis. Parasites and Health. CDC, 20 July 2009. Web.
  5. ^ [5]
  6. ^ Crompton, D.W.T. Reproduction. In Biology of the Acanthocephala (ed. Crompton, D. W. T. & Nickol, B. B.), pp. 213–271. Cambridge University Press, Cambridge. 1985
  7. ^ [6] Libersat, F., and J. Moore. "The Parasite Moniliformis moniliformis Alters the Escape Response of its Cockroach Host Periplaneta americana." Journal of Insect Behavior 13.1 (2000): 103-10. Plenum Publishing. Web.
  8. ^ [7], Moore, J., M. Freehling, and N. J. Gotelli. 1994. Altered behavior in two species of blattid cockroaches infected with Moniliformis moniliformis (Acanthocephala). Journal of Parasitology 80:220–223.
  9. ^ [8], Moore, J. 1983. Altered behaviour in cockroaches (Periplaneta americana) infected with an archiacantho- cephalan Moniliformis moniliformis. J. Parasitol., 69, 1174-1177.
  10. ^ a b c [9], Richardson, Dennis, and Peter J. Krause. Northern American parasitic zoonoses. Vol. 6. Boston: Kluwer Academic, 2003. Print.
  11. ^ [10], Berenji, F., Fata, A., Hosseininejad, Z. A Case of Moniliformis Moniliformis (Acanthocephala) Infection in Iran. Korean Journal of Parasitology Vol. 45, No. 2: 145-148, June 2007
  12. ^ [11], Salehabadi, Alireza; Mowlavi, Gholamreza; Sadjjadi, S.M., Vector-Borne and Zoonotic Diseases. February 2008, 8(1): 101-104.
  13. ^ [12], Neafie, RC, Marty, AM. Unusual infections in humans. Clin Microbiol Rev 1993; 66:34–56.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!