Articles on this page are available in 1 other language: French (1) (learn more)

Overview

Comprehensive Description

Taxonomic History

Melissotarsus insularis Santschi, 1911e PDF: 122, fig. 2 (w.m.) MADAGASCAR. AntCat AntWiki
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Santschi, F., 1911:
 [[soldier]]. Voisin de M. Emeryi For. Long. 2 mill., jaune testace, abdomen jaune terne, mandibules d'un brun roussatre, pattes jaunes; mat. Tete subopaque a stries longitudinales extreme- ment fines et presque indistinctes sur les cotes de la tete; parsemee de points irreguliers et assez discrets. Dos du thorax fortement strie en long. Le sommet de chaque ride, formee par l'intervalle des stries, presente, souvent, une tres fine strie secondaire. Abdomen tres finement reticule. Pilosite dressee irre- guliere, eparse sur le corps, plus confluente sur les tibias, les metatarses et les antennes. Abdomen tres finement pubescent. Cotes de la tete plus arrondis que chez Beccari Em. Yeux 2 fois plus longs que larges, distants du bord anterieur de la tete d'environ leur grand diametre. Portion mediane du clypeus relevee. Antennes comme chez Emeryi, le 3me article du funicule un peu moins large que chez Weissi Sants. Mandibules de 3 a 4 dents, la premiere, tres longue, est separee de la derniere, qui est bien moins forte, par un espace concave derriere lequel on voit, sur un autre plan, un ou deux denticules. Thorax et pedicule comme chez Emeryi. Metatarses posterieurs longs comme les 2/3 des tibias et aussi epais.
  [[male]]. Long. 2,5 mill. Testace. Pilosite plus abondante que chez le [[soldier]]. Submat. Tete, pronotum et abdomen tres finement stries. Reste du dos du thorax superficiellement et finement stries en long. Tete bien plus large que longue, a bord occipital plat, plus large que le bord anterieur. Cotes convexes avec de gros yeux tres bombes places au milieu des cotes et en occupant la moitie de la surface. Ocelles gros et assez espaces. Le scape atteint le bord posterieur de l' oe il. Cretes frontales bien plus ecartees que chez le [[soldier]]. Epistome convexe, non carene. Mandibules etroites, assez courtes, terminees par deux dents distinctes. Le mesonotum de- prime ne depasse pas en avant le pronotum et est sur le meme plan que le scutellum. Epinotum arrondi, sans dent ni bordure, la face basale courte, oblique un peu vers la face declive qui est plus longue. Metatarses aussi longs que les tibias mais de forme ordinaire. 1er article du pedicule comme chez le soldat, gastre court, plus haut en arriere qu'en avant. Les stipes sont grands, triangulaires, a pointes arrondies. Les volselles larges dans leurs deux tiers superieurs et aussi longues que les stipes. Les cerci larges et courts.
  Fig. 2. Melissotarsus insularis . Armure genitale [[male]].
 Deux [[soldier]] et un seul [[male]] en tres mauvais etat et incomplet de Makaraingo (Madagascar), trouves dans une ecorce avec de nombreuses petites galeries! Dr Escoffre 1898. - Museum de Paris.
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

[[soldier]]. Voisin de M. Emeryi For. Long. 2 mill., jaune testace, abdomen jaune terne, mandibules d'un brun roussatre, pattes jaunes; mat. Tete subopaque a stries longitudinales extreme- ment fines et presque indistinctes sur les cotes de la tete; parsemee de points irreguliers et assez discrets. Dos du thorax fortement strie en long. Le sommet de chaque ride, formee par l'intervalle des stries, presente, souvent, une tres fine strie secondaire. Abdomen tres finement reticule. Pilosite dressee irre- guliere, eparse sur le corps, plus confluente sur les tibias, les metatarses et les antennes. Abdomen tres finement pubescent. Cotes de la tete plus arrondis que chez Beccari Em. Yeux 2 fois plus longs que larges, distants du bord anterieur de la tete d'environ leur grand diametre. Portion mediane du clypeus relevee. Antennes comme chez Emeryi, le 3me article du funicule un peu moins large que chez Weissi Sants. Mandibules de 3 a 4 dents, la premiere, tres longue, est separee de la derniere, qui est bien moins forte, par un espace concave derriere lequel on voit, sur un autre plan, un ou deux denticules. Thorax et pedicule comme chez Emeryi. Metatarses posterieurs longs comme les 2/3 des tibias et aussi epais.

 

[[male]]. Long. 2,5 mill. Testace. Pilosite plus abondante que chez le [[soldier]]. Submat. Tete, pronotum et abdomen tres finement stries. Reste du dos du thorax superficiellement et finement stries en long. Tete bien plus large que longue, a bord occipital plat, plus large que le bord anterieur. Cotes convexes avec de gros yeux tres bombes places au milieu des cotes et en occupant la moitie de la surface. Ocelles gros et assez espaces. Le scape atteint le bord posterieur de l' oe il. Cretes frontales bien plus ecartees que chez le [[soldier]]. Epistome convexe, non carene. Mandibules etroites, assez courtes, terminees par deux dents distinctes. Le mesonotum de- prime ne depasse pas en avant le pronotum et est sur le meme plan que le scutellum. Epinotum arrondi, sans dent ni bordure, la face basale courte, oblique un peu vers la face declive qui est plus longue. Metatarses aussi longs que les tibias mais de forme ordinaire. 1er article du pedicule comme chez le soldat, gastre court, plus haut en arriere qu'en avant. Les stipes sont grands, triangulaires, a pointes arrondies. Les volselles larges dans leurs deux tiers superieurs et aussi longues que les stipes. Les cerci larges et courts.

 

Fig. 2. Melissotarsus insularis . Armure genitale [[male]].

 

Deux [[soldier]] et un seul [[male]] en tres mauvais etat et incomplet de Makaraingo (Madagascar), trouves dans une ecorce avec de nombreuses petites galeries! Dr Escoffre 1898. - Museum de Paris.

License not applicable

Santschi, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Melissotarsus insularis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 119 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTATTTATTTTATTTTTGCAATTTGAGCAGGAATAATTGGATCATCAATAAGTATAATAATTCGATTAGAATTAGGTATACCTAACTCTTTAATCAATAACGATCAAATTTATAACTCCTTAGTTACTAGACACGCTTTTATTATAATTTTCTTCATAGTTATACCTTTTATAATTGGAGGATTTGGGAATTTCTTAATTCCTTTAATATTAGGATCTCCAGATATAGCTTATCCTCGAATAAATAATATAAGATTTTGACTCCTTCCTCCTTCTATTACCCTCCTATTAACTAGAAATTTCATTAATAATGGAATTGGGACTGGATGAACAATTTATCCACCTCTATCATCAAACATTTTTCACAGAGGTCCATCTGTTGATCTATCTATTTTTTCTCTACATATTGCTGGAATATCATCAATCTTAGGTGCAATTAATTTTATTTCTACTATCCTAAACATACATCATAAAAACTCTTCTTTA------GATAAAATTCCTTTAATAGTTTGATCTATTTTAATCACTACCATTCTTCTACTCTTAGCTCTTCCCGTCTTAGCAGGTGCAATTACCATATTATTAACAGATCGTAACTTAAACACTTCCTTCTTTGACCCAAGAGGAGGGGGAGACCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Melissotarsus insularis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 279
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!