Physical Description

Type Information

Holotype for Drillia actinocycla Dall & Simpson, 1901
Catalog Number: USNM 159691
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): United States Fish Commission
Locality: Mayaguez, Puerto Rico, North Atlantic Ocean
  • Holotype: Bull. U.S. Fish. Commn. 20(1): 385, pl. 57, fig. 15.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 4.5 - 60
  Temperature range (°C): 23.505 - 26.923
  Nitrate (umol/L): 0.339 - 2.213
  Salinity (PPS): 36.217 - 37.191
  Oxygen (ml/l): 4.672 - 4.801
  Phosphate (umol/l): 0.093 - 0.286
  Silicate (umol/l): 1.217 - 3.306

Graphical representation

Depth range (m): 4.5 - 60

Temperature range (°C): 23.505 - 26.923

Nitrate (umol/L): 0.339 - 2.213

Salinity (PPS): 36.217 - 37.191

Oxygen (ml/l): 4.672 - 4.801

Phosphate (umol/l): 0.093 - 0.286

Silicate (umol/l): 1.217 - 3.306
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Strombus pugilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTATTTGGTATATGGTCCGGTTTAGTTGGGACTGCTTTAAGTCTTCTAATTCGGGCTGAGCTTGGACAGCCAGGAGCCTTATTAGGTGAT---GACCAGCTATACAATGTAATTGTTACAGCTCATGCATTTGTTATAATTTTCTTTTTAGTTATGCCCATGATAATTGGCGGTTTCGGAAATTGACTAGTGCCATTAATACTAGGAGCTCCTGATATGGCTTTTCCTCGATTAAATAATATAAGATTTTGACTTTTACCTCCTGCTCTCCTTTTACTACTTTCGTCAGCGGCCGTTGAAAGCGGAGTAGGTACAGGATGGACAGTTTACCCTCCTCTAGCTGGAAATCTAGCGCATGCTGGCGGATCTGTGGATTTAGCTATTTTTTCTTTACACTTAGCTGGTGTTTCCTCCATTCTAGGAGCGGTTAATTTTATTACTACAATTATTAATATGCGGTGACGGGGAATACAGTTTGAGCGACTCCCACTCTTTGTATGATCAGTTAAGATTACTGCTGTGCTGTTGTTACTTTCTCTACCTGTTTTAGCTGGAGCCATTACAATGCTTCTCACAGATCGTAACTTCAATACTGCATTCTTTGATCCTGCAGGAGGTGGGGATCCAATTTTGTACCAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Strombus pugilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Strombus pugilis

Strombus pugilis, common names the fighting conch, or the West Indian fighting conch, is a species of medium to large sea snail, a marine gastropod mollusk in the family Strombidae, the true conchs.

S. pugilis is closely similar to Strombus alatus, the Florida fighting conch. It is unsettled whether they are distinct species or merely subspecies.

Contents

Shell description

Apertural view of a live but retracted Strombus pugilis out of water in a human hand showing the brown operculum

The maximum recorded shell length is 110 mm[2] or up to 130 mm,[3] commonly to 90 mm.

Like other species in the same genus, Strombus pugilis has a robust, somewhat heavy and solid shell, with a characteristic stromboid notch. It has a well-developed body whorl and a short and pointed spire. It presents 8 to 9 whorls,[4] each of them having a single row of subsutural spines, becoming larger towards the last whorl.[3] These spines, however, may be less conspicuous or even absent in some populations.[5] Its aperture is relatively long and slightly oblique.[4] The posterior angle of the outer lip is distinct, projecting in the posterior direction in an erect fashion.[6] The operculum is sickle-shaped, similar to several other Strombus snails.

The shell color varies from salmon-pink,[4] cream or yellow to light or strong orange, and the interior of the aperture is usually white. The anterior end presents a dark purple stain,[3] which is one of the diagnostic characters of this species, and is absent in Strombus alatus.

This species is closely similar to Strombus alatus, which has a more northerly range. Strombus alatus shells have less prominent subsutural spines and a slightly more projected outer lip. Some scientists have treated the two as distinct species; others as subspecies.[7] In an extensive study of the Stromboidea in 2005, Simone provisionally treated these as distinct species, but observed that "no spectacular morphological difference was found [and] all related differences, even those of the genital system, can be regarded as extreme of variation of a single, wide distributed, variable species."[8]

Distribution

Strombus pugilis lives in Bermuda, southeastern Florida, the Caribbean Sea, and south to Brazil.[3]

Phylogeny

A cladogram based on sequences of nuclear histone H3 gene and mitochondrial cytochrome-c oxidase I (COI) gene showing phylogenetic relationships of (32 analyzed) species in the genus Strombus and Lambis, including Strombus pugilis, was proposed by Latiolais et al (2006).[9] In this hypothesis, Strombus pugilis and Strombus alatus apparently share a common ancestor, and are possibly close related.[9]

Ecology

Habitat

This sea snail lives on sandy and muddy bottoms,[3][5] from the intertidal zone[5] to depths between 2 and 10 m.[6]

Minimum recorded depth is 0 m.[2] Maximum recorded depth is 55 m.[2]

Life cycle

During a long period in the initial stages of its development, the Strombus pugilis larvae feed mainly on plankton.[3] Studies indicate that some populations of Strombus pugilis may reproduce throughout the year.[10]

Feeding habits

Strombus pugilis is known to be a herbivore, feeding on plants and algae.[11]

Human uses

The flesh of Strombus pugilis is edible.[4] It is usually cooked by boiling, and is consumed by local fishermen.

Strombus pugilis is used as a zootherapeutical product for the treatment of sexual impotence in the traditional Brazilian medicine of the Northeast region of Brazil.[12]

The shell is commonly used as a decorative item, and is sold in local markets as a souvenir.

References

  1. ^ Rosenberg, G. (2009). "Malacolog 4.1.1: A Database of Western Atlantic Marine Mollusca". Strombus pugilis Linnaeus, 1758. http://www.malacolog.org/search.php?nameid=2211. Retrieved 28 March 2010.
  2. ^ a b c Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
  3. ^ a b c d e f Leal, J.H. (2002). Gastropods. p. 99-147. In: Carpenter, K.E. (ed.). The living marine resources of the Western Central Atlantic. Volume 1: Introduction, molluscs, crustaceans, hagfishes, sharks, batoid fishes, and chimaeras. FAO Species Identification Guide for Fishery Purposes and American Society of Ichthyologists and Herpetologists Special Publication No. 5. 1600p.
  4. ^ a b c d Rios, E. C. (1994). Seashells of Brazil (2nd ed.). Rio Grande: FURG. ISBN 85-85042-36-2.
  5. ^ a b c Simone, L. R. L. (2005). "Comparative morphological study of representatives of the three families of Stromboidea and the Xenophoroidea (Mollusca, Caenogastropoda), with an assessment of their phylogeny". Arquivos de Zoologia (São Paulo, Brazil: Museu de Zoologia da Universidade de São Paulo) 37 (2): 141–267. ISSN 0066-7870. http://www.revistasusp.sibi.usp.br/pdf/azmz/v37n2/a01v37n2.pdf.
  6. ^ a b Cervigón, F. et al. (1993): FAO species identification sheets for fishery purposes. Field guide to the commercial marine and brackish-water resources of the northern coast of South America. Rome, FAO. 513 p.
  7. ^ Simone (2005): Comparative Morphological study of representatives of the three families of Stromboidea and the Xenophoroidea (Mollusca, Caenogastropoda), with an assessment of their phylogeny, p. 142.
  8. ^ Simone (2005): Comparative Morphological study of representatives of the three families of Stromboidea and the Xenophoroidea (Mollusca, Caenogastropoda), with an assessment of their phylogeny, p. 169.
  9. ^ a b c Latiolais J. M., Taylor M. S., Roy K. & Hellberg M. E. (2006). "A molecular phylogenetic analysis of strombid gastropod morphological diversity". Molecular Phylogenetics and Evolution 41: 436-444. doi:10.1016/j.ympev.2006.05.027. PDF.
  10. ^ Cardenas, E.B., D. Aldana Aranda, and G. Martínez Olivares. (2005). Gonad development and reproductive pattern of the fighting conch Strombus pugilis (Lineé, 1758) (Gastropoda, Prosobranchia) from Campeche, Mexico. Journal of Shellfish Research 24(4):1127-1133.
  11. ^ Robertson, R. (1961). The feeding of Strombus and related herbivorous marine gastropods. Natul. Nat. 343: 1-9
  12. ^ Alves R. R. N. 2009. Fauna used in popular medicine in Northeast Brazil. Journal of Ethnobiology and Ethnomedicine 2009, 5:1. doi:10.1186/1746-4269-5-1. The species is incorrectly spelled in the reference as Strombus puginis.
  • Rosenberg, G., F. Moretzsohn, and E. F. García. 2009. Gastropoda (Mollusca) of the Gulf of Mexico, Pp. 579–699 in Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!