Overview

Comprehensive Description

Color: Shell greenish to brownish, interior not nacreous. Periostracum thick, brownish green.
  • BATES B. & V. TUNNICLIFFE (2006) Mar. Ecol. Prog. Ser. 305: 1-15.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

On vestimentiferan tubes, extremely common. Occasionally, near acidic outflows, the calcareous layer may be dissolved and the living animal is surrounded only by the strong periostracum. Monotypic genus endemic to vents. Stomach contains amorphous organic matter. Larval development lecithotrophic with planktonic dispersal stage.
  • BATES B. & V. TUNNICLIFFE (2006) Mar. Ecol. Prog. Ser. 305: 1-15.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Juan de Fuca Ridge.
  • BATES B. & V. TUNNICLIFFE (2006) Mar. Ecol. Prog. Ser. 305: 1-15.
  • HASZPRUNAR G. (1989) Nat. Hist. Mus. Los Angeles Cty., Contrib. Sci. 408: 1-17 [3].

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Shell broader than high with rather large body whorl, about three whorls; aperture subcircular with an indistinct shallow basal notch. Umbilicus reduced to a small chink, suture deep. Protoconch strongly ridged, teleoconch with irregular incremental lines, otherwise smooth. Operculum multispiral, densely coiled, with central nucleus. Animal with tentacles of even size in both sexes and a snout of approximately even width.
  • BATES B. & V. TUNNICLIFFE (2006) Mar. Ecol. Prog. Ser. 305: 1-15.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Shell diameter up to 5.4 mm.
  • BATES B. & V. TUNNICLIFFE (2006) Mar. Ecol. Prog. Ser. 305: 1-15.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Depressigyra globulus Waren & Bouchet, 1989
Catalog Number: USNM 859228
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry; Alcohol (Ethanol)
Collector(s): Hardiman, Malahoff & Feeley
Year Collected: 1984
Locality: Juan De Fuca Ridge, Endeavour Segment, North Pacific Ocean
Depth (m): 2208 to 2250
Vessel: Alvin DSR/V
  • Paratype: Waren, A. & Bouchet, P. 1989. Zool. Scr. 18: 67-102.; War?n, A. & Bouchet, P. 1989. Zool. Scr. vol. 18(1)-67-102.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Depressigyra globulus Waren & Bouchet, 1989
Catalog Number: USNM 859230
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): Hardiman, Malahoff & Feeley
Year Collected: 1984
Locality: Juan De Fuca Ridge, Endeavour Segment, North Pacific Ocean
Depth (m): 2208 to 2250
Vessel: Alvin DSR/V
  • Paratype: Waren, A. & Bouchet, P. 1989. Zool. Scr. 18: 67-102.; War?n, A. & Bouchet, P. 1989. Zool. Scr. vol. 18(1)-67-102.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Depressigyra globulus Waren & Bouchet, 1989
Catalog Number: USNM 836329
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Hardiman, Malahoff & Feeley
Year Collected: 1984
Locality: Juan De Fuca Ridge, Endeavour Segment, North Pacific Ocean
Microhabitat: Hydrothermal vents
Depth (m): 2208 to 2250
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Depressigyra globulus Waren & Bouchet, 1989
Catalog Number: USNM 859229
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): Hardiman, Malahoff & Feeley
Year Collected: 1984
Locality: Juan De Fuca Ridge, Endeavour Segment, Washington, United States, North Pacific Ocean
Depth (m): 2208 to 2208
Vessel: Alvin DSR/V
  • Holotype: Waren, A. & Bouchet, P. 1989. Zool. Scr. 18: 67-102.; War?n, A. & Bouchet, P. 1989. Zool. Scr. vol. 18(1)-67-102.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

hydrothermal vents and seeps
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 15 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.

Environmental ranges
  Depth range (m): 1519.5 - 3232
  Temperature range (°C): 1.622 - 2.777
  Nitrate (umol/L): 34.711 - 44.610
  Salinity (PPS): 34.493 - 34.659
  Oxygen (ml/l): 0.774 - 3.998
  Phosphate (umol/l): 2.419 - 3.172
  Silicate (umol/l): 68.288 - 176.826

Graphical representation

Depth range (m): 1519.5 - 3232

Temperature range (°C): 1.622 - 2.777

Nitrate (umol/L): 34.711 - 44.610

Salinity (PPS): 34.493 - 34.659

Oxygen (ml/l): 0.774 - 3.998

Phosphate (umol/l): 2.419 - 3.172

Silicate (umol/l): 68.288 - 176.826
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Depressigyra globulus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTCTTTACATTTTACTAGGAATATGATCAGCTCTCTTAGGAACCGGGCTTAGTATACTAATTCGTATAGAACTTGGACAACCAGGTAGCCTATTAGGAGAT---GACCAACTTTACAATGTAATTGTAACAGCACATGCTTTTATTATGATTTTTTTCTTTGTAATACCAATGATAATTGGGGGATTTGGTAATTGGTTAGTTCCACTTATGTTAGGAGCCCCAGACATGGCTTTTCCTCGACTAAATAACATAAGTTTTTGGCTTCTTCCTCCTTCTTTAACTTTACTTCTTTCTTCAGCTGCTGTAGAAAGAGGTGTAGGGACAGGGTGGACTATATATCCTCCTTTAGCAAGAAACTTAGCACATGCAGGTTCTGCAGTTGATTTTGCTATTTTCTCTTTACACTTAGCAGGGATTGCTTCAATTTTAGGGGCTATTAACTTTATTACAACAGTTCTTAATATACGTTGACGTGGAATACAGCTAGAGCGAGTTCCATTATTCGTATGGTCAGTAAAAATTACAGCCGTCCTACTTCTTTTATCCCTGCCCGTACTAGCCGGAGCTATTACTATGCTACTGACTGACCGAAATTTTAACACTGCTTTTTTTGACCCAGCTGGTGGGGGTGACCCCGTTCTTTTCCAGCAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Depressigyra globulus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Bermuda Aquarium, Museum and Zoo
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Depressigyra globulus

Depressigyra globulus is a species of sea snail, a marine gastropod mollusk in the family Peltospiridae.[1]

Contents

Description

Distribution

References

  1. ^ a b Depressigyra globulus Warén & Bouchet, 1989.  Retrieved through: World Register of Marine Species on 11 April 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!