Overview

Comprehensive Description

Color: White.
  • WAREN A. & P. BOUCHET (1989) Zool. Scr. 18: 67-102 [69-70].

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Specimens have been found in abundance in washings of Riftia tubes, more rarely with Alvinella tubes. Monotypic genus endemic to vents. Probably a filter-feeder, possibly in combination with cleaning the worms? tubes of bacterial growth. Larval development lecithotrophic with planktonic dispersal stage.
  • WAREN A. & P. BOUCHET (1989) Zool. Scr. 18: 67-102 [69-70].

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

East Pacific Rise: 9-21°N.
  • WAREN A. & P. BOUCHET (1989) Zool. Scr. 18: 67-102 [69-70].

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Shell globular, regularly coiled, without sculpture. Adults with deep notch in the lower part of the outer lip. Very large bipectinate gill. Left cephalic tentacle modified to a penis.
  • WAREN A. & P. BOUCHET (1989) Zool. Scr. 18: 67-102 [69-70].

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Shell diameter up to 7 mm.
  • WAREN A. & P. BOUCHET (1989) Zool. Scr. 18: 67-102 [69-70].

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size under dissecting microscope: 240µm
  Size under compound microscope:  230-240µm

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Morphology

    Cyathermia naticoides has a moderately large protoconch. The posterior is covered by coarse reticulate sculpture which gives the appearance of bubbles under the light microscope. The anterior portion is smooth. The aperture is slightly sinuous and there is a medium-width rim.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Cyathermia naticoides War?n & Bouchet, 1989
Catalog Number: USNM 859223
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Year Collected: 1984
Locality: East Pacific Rise, At Site Near 13 N, Mexico, North Pacific Ocean
Depth (m): 2635 to 2635
Vessel: Cyana DSR/V
  • Paratype: War?n, A. & Bouchet, P. 1989. New Gastropods from East Pacific hydrothermal vents. Zool. Scr. 18 (1): 67-102.; War?n, A. & Bouchet, P. 1989. New Gastropods from East Pacific hydrothermal vents. Zool. Scr. 18 (1): 67-102.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype; Paratype for Cyathermia naticoides War?n & Bouchet, 1989
Catalog Number: USNM 859222
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Year Collected: 1984
Locality: East Pacific Rise, At Site Near 13 N, Mexico, North Pacific Ocean
Depth (m): 2635 to 2635
Vessel: Cyana DSR/V
  • Paratype: War?n, A. & Bouchet, P. 1989. New Gastropods from East Pacific hydrothermal vents. Zool. Scr. 18 (1): 67-102.; War?n, A. & Bouchet, P. 1989. New Gastropods from East Pacific hydrothermal vents. Zool. Scr. 18 (1): 67-102.; Paratype: War?n, A. & Bouchet, P. 1989. New Gastropods from East Pacific hydrothermal vents. Zool. Scr. 18 (1): 67-102.; War?n, A. & Bouchet, P. 1989. New Gastropods from East Pacific hydrothermal vents. Zool. Scr. 18 (1): 67-102.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Can be confused with:

The protoconchs can be easily confused with those of Neomphalus fretterae, although the adults look quite different. The chief differences between the two are that Neomphalus has finer reticulate sculpture and the outer edge flares out at the aperture. The aperture rim is wider in Neomphalus than in Cyathermia, tapering toward the posterior edge.    

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

hydrothermal vents and seeps
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 53 specimens in 1 taxon.
Water temperature and chemistry ranges based on 49 samples.

Environmental ranges
  Depth range (m): 1800 - 3050
  Temperature range (°C): 1.823 - 2.889
  Nitrate (umol/L): 21.028 - 41.112
  Salinity (PPS): 34.661 - 34.944
  Oxygen (ml/l): 2.426 - 5.742
  Phosphate (umol/l): 1.396 - 2.812
  Silicate (umol/l): 34.435 - 161.666

Graphical representation

Depth range (m): 1800 - 3050

Temperature range (°C): 1.823 - 2.889

Nitrate (umol/L): 21.028 - 41.112

Salinity (PPS): 34.661 - 34.944

Oxygen (ml/l): 2.426 - 5.742

Phosphate (umol/l): 1.396 - 2.812

Silicate (umol/l): 34.435 - 161.666
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cyathermia naticoides

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTATACATGCTTTTCGGTATATGAACTGCTTTACTAGGAACAGGGATAAGTATTATTATTCGTGTAGAATTAGGGCAGCCAGGAAGTTTCTTAGGGGAC---GACCAGTTGTACAATGTAATTGTAACAGCTCATGCTTTTGTAATGTTATTCTTCTTTGTTATGCCTATGATGATGGGAGGATTCGGAAATTACTTAGTTCCTTTAATGTTAGGGGCTCCAGATATGGCGTTCCCACGTTTAAATAACATAAGTTTCTGATTACTACCACCTTCATTAACTTTACTTTTAGCTTCAGCAGCAGTTGAAAGTGGGATAGGAACAGGATGAACTGTCTATCCTCCTTTATCAAGTAATCTTGCTCACGCAGGATCTGCAGTTGATTTTGCTATTTTCTCTATTCACTTAGCTGGAATTGCTTCAATTCTAGGGTCAATTAATTTTATTACTACTGTTTTAAACATGCGTTGACGAGGAATACAGTTAGAACGAGTTCCTTTATTTGTTTGATCTGTAAAAATTACAGCTGTTTTATTACTTCTATCTCTTCCTGTATTGGCTGGGGCTGTTACTATGTTGTTAACAGATCGTAATTTCAATACTGCCTTCTTCGATCCAGCAGGAGGGGGGGACCCAATTCTTTATCAACACTTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cyathermia naticoides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cyathermia naticoides

Cyathermia naticoides is a species of sea snail, a marine gastropod mollusk in the family Neomphalidae.[1]

Contents

Description

Distribution

References

  1. ^ Cyathermia naticoides Warén & Bouchet, 1989.  Retrieved through: World Register of Marine Species on 11 April 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!