Overview
Comprehensive Description
Color: White.
- WAREN A. & P. BOUCHET (1989) Zool. Scr. 18: 67-102 [69-70].
Trusted
Specimens have been found in abundance in washings of Riftia tubes, more rarely with Alvinella tubes. Monotypic genus endemic to vents. Probably a filter-feeder, possibly in combination with cleaning the worms? tubes of bacterial growth. Larval development lecithotrophic with planktonic dispersal stage.
- WAREN A. & P. BOUCHET (1989) Zool. Scr. 18: 67-102 [69-70].
Trusted
Distribution
East Pacific Rise: 9-21°N.
- WAREN A. & P. BOUCHET (1989) Zool. Scr. 18: 67-102 [69-70].
Trusted
Physical Description
Morphology
Shell globular, regularly coiled, without sculpture. Adults with deep notch in the lower part of the outer lip. Very large bipectinate gill. Left cephalic tentacle modified to a penis.
- WAREN A. & P. BOUCHET (1989) Zool. Scr. 18: 67-102 [69-70].
Trusted
Size
Shell diameter up to 7 mm.
- WAREN A. & P. BOUCHET (1989) Zool. Scr. 18: 67-102 [69-70].
Trusted
| Size under dissecting microscope: 240µm Size under compound microscope: 230-240µm |
Trusted
Morphology
| Cyathermia naticoides has a moderately large protoconch. The posterior is covered by coarse reticulate sculpture which gives the appearance of bubbles under the light microscope. The anterior portion is smooth. The aperture is slightly sinuous and there is a medium-width rim. |
Trusted
Type Information
Paratype for Cyathermia naticoides War?n & Bouchet, 1989
Catalog Number: USNM 859223
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Year Collected: 1984
Locality: East Pacific Rise, At Site Near 13 N, Mexico, North Pacific Ocean
Depth (m): 2635 to 2635
Vessel: Cyana DSR/V
Catalog Number: USNM 859223
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Year Collected: 1984
Locality: East Pacific Rise, At Site Near 13 N, Mexico, North Pacific Ocean
Depth (m): 2635 to 2635
Vessel: Cyana DSR/V
- Paratype: War?n, A. & Bouchet, P. 1989. New Gastropods from East Pacific hydrothermal vents. Zool. Scr. 18 (1): 67-102.; War?n, A. & Bouchet, P. 1989. New Gastropods from East Pacific hydrothermal vents. Zool. Scr. 18 (1): 67-102.
Trusted
Paratype; Paratype for Cyathermia naticoides War?n & Bouchet, 1989
Catalog Number: USNM 859222
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Year Collected: 1984
Locality: East Pacific Rise, At Site Near 13 N, Mexico, North Pacific Ocean
Depth (m): 2635 to 2635
Vessel: Cyana DSR/V
Catalog Number: USNM 859222
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Year Collected: 1984
Locality: East Pacific Rise, At Site Near 13 N, Mexico, North Pacific Ocean
Depth (m): 2635 to 2635
Vessel: Cyana DSR/V
- Paratype: War?n, A. & Bouchet, P. 1989. New Gastropods from East Pacific hydrothermal vents. Zool. Scr. 18 (1): 67-102.; War?n, A. & Bouchet, P. 1989. New Gastropods from East Pacific hydrothermal vents. Zool. Scr. 18 (1): 67-102.; Paratype: War?n, A. & Bouchet, P. 1989. New Gastropods from East Pacific hydrothermal vents. Zool. Scr. 18 (1): 67-102.; War?n, A. & Bouchet, P. 1989. New Gastropods from East Pacific hydrothermal vents. Zool. Scr. 18 (1): 67-102.
Trusted
Look Alikes
Can be confused with:
![]() | The protoconchs can be easily confused with those of Neomphalus fretterae, although the adults look quite different. The chief differences between the two are that Neomphalus has finer reticulate sculpture and the outer edge flares out at the aperture. The aperture rim is wider in Neomphalus than in Cyathermia, tapering toward the posterior edge. |
Trusted
Ecology
Habitat
hydrothermal vents and seeps
-
Warén, A. & Bouchet, P. (2001) Gastropoda and Monoplacophora from hydrothermal vents and seeps; new taxa and records. The Veliger, 44, 116–231.
http://www.marinespecies.org/mollusca/aphia.php?p=sourcedetails&id=138366
Trusted
Depth range based on 53 specimens in 1 taxon.
Water temperature and chemistry ranges based on 49 samples.
Environmental ranges
Depth range (m): 1800 - 3050
Temperature range (°C): 1.823 - 2.889
Nitrate (umol/L): 21.028 - 41.112
Salinity (PPS): 34.661 - 34.944
Oxygen (ml/l): 2.426 - 5.742
Phosphate (umol/l): 1.396 - 2.812
Silicate (umol/l): 34.435 - 161.666
Graphical representation
Depth range (m): 1800 - 3050
Temperature range (°C): 1.823 - 2.889
Nitrate (umol/L): 21.028 - 41.112
Salinity (PPS): 34.661 - 34.944
Oxygen (ml/l): 2.426 - 5.742
Phosphate (umol/l): 1.396 - 2.812
Silicate (umol/l): 34.435 - 161.666
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 49 samples.
Environmental ranges
Depth range (m): 1800 - 3050
Temperature range (°C): 1.823 - 2.889
Nitrate (umol/L): 21.028 - 41.112
Salinity (PPS): 34.661 - 34.944
Oxygen (ml/l): 2.426 - 5.742
Phosphate (umol/l): 1.396 - 2.812
Silicate (umol/l): 34.435 - 161.666
Graphical representation
Depth range (m): 1800 - 3050
Temperature range (°C): 1.823 - 2.889
Nitrate (umol/L): 21.028 - 41.112
Salinity (PPS): 34.661 - 34.944
Oxygen (ml/l): 2.426 - 5.742
Phosphate (umol/l): 1.396 - 2.812
Silicate (umol/l): 34.435 - 161.666
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Cyathermia naticoides
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
TTATACATGCTTTTCGGTATATGAACTGCTTTACTAGGAACAGGGATAAGTATTATTATTCGTGTAGAATTAGGGCAGCCAGGAAGTTTCTTAGGGGAC---GACCAGTTGTACAATGTAATTGTAACAGCTCATGCTTTTGTAATGTTATTCTTCTTTGTTATGCCTATGATGATGGGAGGATTCGGAAATTACTTAGTTCCTTTAATGTTAGGGGCTCCAGATATGGCGTTCCCACGTTTAAATAACATAAGTTTCTGATTACTACCACCTTCATTAACTTTACTTTTAGCTTCAGCAGCAGTTGAAAGTGGGATAGGAACAGGATGAACTGTCTATCCTCCTTTATCAAGTAATCTTGCTCACGCAGGATCTGCAGTTGATTTTGCTATTTTCTCTATTCACTTAGCTGGAATTGCTTCAATTCTAGGGTCAATTAATTTTATTACTACTGTTTTAAACATGCGTTGACGAGGAATACAGTTAGAACGAGTTCCTTTATTTGTTTGATCTGTAAAAATTACAGCTGTTTTATTACTTCTATCTCTTCCTGTATTGGCTGGGGCTGTTACTATGTTGTTAACAGATCGTAATTTCAATACTGCCTTCTTCGATCCAGCAGGAGGGGGGGACCCAATTCTTTATCAACACTTGTTC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Cyathermia naticoides
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Trusted
Wikipedia
Cyathermia naticoides
Cyathermia naticoides is a species of sea snail, a marine gastropod mollusk in the family Neomphalidae.[1]
Contents |
Description
| This section is empty. You can help by adding to it. (April 2010) |
Distribution
| This section is empty. You can help by adding to it. (April 2010) |
References
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!



