Overview

Comprehensive Description

Description

 

"Nacella mytilina (Helbling, 1779)
(Pl. 73, fig. 9; Pls. 173, 174)

 

 

Range-Southern Chile, Straits of Magellan, Tierra del Fuego, Falkland Islands and Kerguelen Island.

 

Description-Shell rather small, up to 43 mm. (1⅝ inches) in length, elliptical, thin and fragile, with the apex almost at the anterior end. Usually the surface is almost smooth, but occasionally moderate radial ridges are developed, as well as corrugations around the anterior margin. Colour greenish olive to light brownish, sometimes red­dish bronze at the apex, and the interior is silvery iridescent.

 

Measurements (mm.)-(all A.W.B. Powell col­lection).

                            
 

length

 
 

width

 
 

height

 
 

 
 

43.0

 
 

26.0

 
 

18.0

 
 

Punta Arenas

 
 

34.5

 
 

23.0

 
 

11.0

 
 

Falkland Islands

 
 

27.0

 
 

18.0

 
 

7.5

 
 

Hermit Id., Cape Horn

 
 

 

Synonymy

 

 

1779 Patella mytilina Helbling, Abh. Privatges. Bohm., vol. 4, p. 104, pl. 1, figs. 5, 6.

 

1786 Patella mytiliformis Lightfoot, Cat. Portland Mus., p. 42.

 

1791 Patella conchacea Gmelin, Syst. Nat. ed. 13, p. 3708.

 

1817 Nacella mytiloides Schumacher, Essai Vers test., p. 179.

 

1819 Patella cymbularia Lamarck, Anim. sans Vert., vol. 6, p. 335.

 

1831 Patella cymbuloides Lesson, Voy. de la Coquille, p. 422.

 

1845 Patella hyalina Philippi, Arch. f. Naturg., vol. 11, p. 59.

 

1845 Patella cymbium Philippi, Arch. f. Naturg., vol. 11, p. 60.

 

1845 Patella vitrea Philippi, Arch. f. Naturg., vol. 11, p. 60.

 

1869 Nacella compressa Rochebrune & Mabille, Mission scient. Cap Horn, vol. 6, p. 98, pl. 5, fig. 9.

 

1913 Nacella falklandica Preston, Ann. Mag. Nat. Hist., ser. 8, vol. 11, p. 221, pl. 4, fig. 6.

 

1950 Nacella mytilina Helbling, Carcelles, Anales del Museo Nahuel Huapi, vol. 2, p. 52 (Kerguelen).

 

1951 Nacella mytilina Helbling Powell, Discovery Rep., vol. 26, p. 80.

 

1964 Nacella mytilina Helbling, Dell, Rec. Domin. Mus., vol. 4, no. 20, p. 273.

 

 

Records-STRAITS OF MAGELLAN (type locality): Punta Arenas; St. Martin's Cove, Hermite Island, Cape Horn. PAT­Agonia: mouth of Santa Cruz River. FALKLAND ISLANDS (all AWBP coll.). KERGUELEN ISLAND: Swain's Bay, intertidal and Antares Island, intertidal (BANZARE Sta. 48 and Sta. 61)."

 

 

(Powell, 1973: 192)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© National Museum of Natural History, Smithsonian Institution

Source: Antarctic Invertebrates Website (NMNH)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 2.5 - 2.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Nacella mytilina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 32
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Nacella mytilina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATATATTATTTTGGGAGTTTGGTCTGGGCTTGCTGGGACTGGTTTAAGTATGCTTATTCGTGCTGAGCTAGGGCAGCCTGGAGCTTTGTTAGGTGAT---GATCAGCTGTATAACGTTATTGTTACTGCTCACGCTTTTGTAATAATTTTTTTTTTAGTAATGCCTATAATAATTGGTGGATTTGGTAATTGGCTTGTTCCTTTAATATTAGGGGCCCCTGATATGGCTTTTCCCCGGTTGAATAACATGAGTTTTTGACTGCTTCCTCCTTCTTTGTTTTTATTGCTGAGTTCTTCGGCGGTTGAAAGTGGGGTTGGAACCGGATGAACCGTTTATCCACCGTTGTCTAGGAACGTTGCTCATTCTGGTGCTTCTGTAGATTTGGCTATTTTCTCTCTTCATTTGGCTGGTGTGTCTTCTATTTTAGGTGCTGTTAATTTTATTACTACTGTTATTAATATTCGGTGACAAGGGCTTCAGTTTGAGCGGCTTCCGTTGTTTGTTTGGTCTGTGAAAATTACTGCCATTTTACTTCTTCTTTCTTTACCCGTTCTGGCTGGTGCTATTACTATGCTTCTAACTGATCGTAACTTTAATACTTGTTTTTTTGATCCCGGAGGTGGTGGTGACCCTATTCTTTATCAGCATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Nacella mytilina

Nacella mytilina is a species of sea snail, a true limpet, a marine gastropod mollusk in the family Nacellidae, one of the families of true limpets.[1]

Contents

Description

Distribution

References

  1. ^ Nacella mytilina (Helbling, 1779).  Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=456658 on 8 April 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!