Overview

Comprehensive Description

Description

 

"Nacella deaurata subspecies deaurata

 

(Gmelin, 1791)

 

 

(Pl. 73, fig. 11; Pls. 174, 175)

 

Range-Southern Patagonia, Straits of Magellan, Tierra del Fuego and Falkland Islands.

 

Remarks-The species is nearest allied to magellanica which is more broadly ovate in outline and lacks nodulation of the radials.

 

Description-Shell of moderate size, up to 61 mm. (2⅜ inches) in length, rather solid, tall conical, narrowly ovate, and with the apex at about the anterior third. Sculpture consisting of from 36 to 40 strong radial ribs, which are rendered strongly scabrous to nodular by numerous overriding concentric lamellose lirae. Colour yellowish-brown to reddish-brown, rending dark reddish-brown to bronze over the apical area. Interior silvery with a pinkish lustre, more or less rayed and mottled with reddish-bronze, the spatula and spotted marginal border dark red­dish-brown.

 

Measurements (mm.)-

                            
 

length

 
 

width

 
 

height

 
 

 
 

61.0

 
 

43.0

 
 

27.0

 
 

Falkland Islands

 
 

57.0

 
 

43.0

 
 

24.0

 
 

Falkland Islands

 
 

48.0

 
 

34.0

 
 

19.5

 
 

Falkland Islands

 
 

 

Synonymy

 

1784 Patella aenea Martyn, Univ. Conch., vol. 1, fig. 17 (invalid).

 

1791 Patella deaurata Gmelin, Syst. Nat. ed. 13, p. 3719, based upon Martini-Chemnitz, Conch. Cab., vol. 10, p. 327, pl. 168, figs. 1616 a, b.

 

1854 Patella varicosa Reeve, Conch. Iconica, pl. 11, figs. 21 a-c.

 

1885 Nacella strigatella Rochebrune and Mabille, Bull. Soc. Phil. Paris, ser. 7, vol. 9, p. 110.

 

1891 Nacella (Patinella) aenea Martyn, Pilsbry, Man. Conch. vol. 13, p. 118, pl. 46, figs. 28-36.

 

1913 Helcioniscus bennetti Preston, Ann. Mag. Nat. Hist. ser. 8, vol. 11, p. 221, pl. 4, fig. 7.

 

1951 Patinigera aenea Martyn, Powell, Discovery Rep. vol. 26, p. 82."

 

 

(Powell, 1973: 195)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© National Museum of Natural History, Smithsonian Institution

Source: Antarctic Invertebrates Website (NMNH)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Nacella deaurata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 41
Specimens with Barcodes: 41
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Nacella deaurata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATATATTATTTGGGGAGTTTGGTCTGGGCTTGCTGGGACTGGTTTAAGTATGCTTATTCGTGCTGAGCTAGGGCAGCCTGGAGCTTTGTTAGGTGAT---GATCAGCTGTATAACGTTATTGTTACTGCTCACGCTTTTGTAATAATTTTTTTTTTAGTAATGCCTATAATAATTGGTGGATTTGGTAATTGGCTTGTTCCTTTAATATTAGGGGCTCCTGATATGGCTTTTCCCCGGTTGAATAACATGAGTTTTTGACTGCTTCCTCCTTCTTTGTTTTTATTGCTGAGTTCTTCGGCGGTTGAAAGTGGGGTTGGAACCGGATGAACCGTTTATCCGCCGTTGTCTAGGAACGTTGCTCATTCTGGTGCTTCTGTAGATTTGGCTATTTTCTCTCTTCATTTGGCTGGTGTGTCTTCTATTTTAGGTGCTGTTAATTTTATTACTACTGTTATTAATATTCGGTGACAAGGGCTTCAGTTTGAGCGGCTTCCGCTGTTTGTTTGGTCTGTGAAAATTACTGCCATTTTACTTCTTCTTTCTTTACCCGTTCTGGCTGGTGCTATTACTATGCTTCTAACTGATCGTAACTTTAATACTTGTTTTTTTGATCCCGGAGGTGGTGGTGACCCTATTCTTTATCAGCATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Nacella deaurata

Nacella deaurata is a species of sea snail, a true limpet, a marine gastropod mollusk in the family Nacellidae, one of the families of true limpets.[1]

Contents

Description

Distribution

References

  1. ^ Nacella deaurata (Gmelin, 1791). World Register of Marine Species, accessed 8 April 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!