Molecular Biology and Genetics

Molecular Biology

Barcode data: Haliotis cyclobates

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CTTCTCATTCGGGCAGAGCTCGGCCAACCGGGGGCACTTCTCGGGGAC---GATCAACTCTACAACGTAATTGTAACAGCTCACGCTTTCGTTATAATCTTTTTCCTAGTTATGCCGCTAATAATCGGAGGATTCGGAAATTGACTAGTCCCACTGATGCTAGGGGCACCTGACATGGCTTTCCCTCGACTAAATAACATAAGATTCTGGCTCCTCCCCCCTTCACTGACTCTCTTACTAACATCAGGTGCTGTAGAAAGTGGTGCCGGGACAGGATGAACAGTCTACCCCCCTCTATCTAGTAACCTGGCCCATGCCGGTGCATCAGTAGACTTAGCAATTTTTTCACTTCACCTAGCCGGGATCTCATCAATCCTAGGAGCAGTCAACTTCATCACCACCGTCATAAACATACGGGTAAAAGCCCAACCGCTAGAGCGAATACCTCTGTTTGTGTGGTCTGTAAAAATTACAGCCATTCTCCTTCTTCTCTCCCTCCCAGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Haliotis cyclobates

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Haliotis cyclobates

Haliotis cyclobates, common name the whirling abalone or the circular ear shell, is a species of sea snail, a marine gastropod mollusk in the family Haliotidae, the abalones.[1]

Description[edit]

The size of the shell attains 60 mm. "The elevated shell is nearly circular in outline and somewhat turbinate. The distance of the apex from the margin is between one-third and one-fourth the greater than the diameter of the shell. The body whorl is rounded and convex above. The surface is covered with spiral cords and threads, and has numerous folds radiating from the suture. The five perforations are oval, not raised. The shell is nearly circular and very convex. The spire is decidedly elevated and is formed of about three rounded whorls. The last whorl has a blunt keel at the row of holes, and a narrower, more acute carina at a short distance below it. The space between both is a little concave. The entire surface has close spiral cords and threads which are sometimes somewhat granose. There are numerous folds radiating from the suture, but not long enough to reach the periphery. The coloration consists of broad radiating patches or oblique stripes of chestnut-brown, green and flesh-color or whitish. The inner surface is silvery with red and green reflections. The muscle impression is not distinct. The columellar plate is flat, not truncate below, strongly sloping inward. The generally five perforations are oval, their edges only a trifle raised." [2]

Distribution[edit]

This marine species is endemic to Australia and occurs off South Australia, Victoria and Western Australia.

References[edit]

  • Péron, F. 1816. Voyage de découvertes aux Terres Australes [Historique]: exécuté par ordre de Sa Majesté l'empereur et roi, sur les corvettes le Geographe, le Naturaliste, et la goelette le Casuarina, pendant les années 1800, 1801, 1802, 1803 et 1804. Paris : Imprimerie imperiale.
  • Lamarck, J.B.P.A. de M. 1822. Histoire Naturelle des Animaux sans Vertèbres. Suite des Gastéropodes. Paris : J.B. Lamarck Vol. 6(2) 232 pp.
  • Wilson, B. 1993. Australian Marine Shells. Prosobranch Gastropods. Kallaroo, Western Australia : Odyssey Publishing Vol. 1 408 pp.
  • Geiger, D.L. & Poppe, G.T. 2000. A Conchological Iconography. The family Haliotidae. Germany : ConchBooks 135 pp.
  • Geiger, D.L. 2000 [1999]. Distribution and biogeography of the recent Haliotidae (Gastropoda: Vetigastropoda) world-wide. Bollettino Malacologico 35(5-12): 57-120
  • Degnan, S.D., Imron, Geiger, D.L. & Degnan, B.M. 2006. Evolution in temperate and tropical seas: disparate patterns in southern hemisphere abalone (Mollusca: Vetigastropoda: Haliotidae). Molecular Phylogenetics and Evolution 41: 249-256
  • Geiger D.L. & Owen B. (2012) Abalone: Worldwide Haliotidae. Hackenheim: Conchbooks. viii + 361 pp.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!