Overview

Brief Summary

The trematode flatworm Clonorchis sinensis (the Chinese River Fluke) lives in the liver of humans and is the cause of clonorchiasis. Clonorchiasis is endemic in East Asia (east Russia and Manchuria, South Korea, mainland China [except the northwest], Taiwan, and northern Vietnam), where tens of millions of people are infected (Lim 2011). It has also been reported in non-endemic areas (including the United States), where it occurs in Asian immigrants or following the ingestion of imported undercooked or pickled freshwater fish containing metacercariae.

Infection by liver flukes can cause chronic parasitic inflammatory disease of the bile ducts. Infection occurs through ingestion of raw or undercooked fluke-infested freshwater fish. The best known species causing human infection are Clonorchis sinensis, Opisthorchis felineus, and O. viverrini. Adult flukes settle in the small intrahepatic bile ducts of the host, then live there for 20 to 30 years. The long-lived flukes cause long-lasting chronic inflammation of the bile ducts and this produces epithelial hyperplasia, periductal fibrosis, and bile duct dilatation. The vast majority of human hosts are asymptomatic, but individuals with heavy infections may suffer from lassitude and nonspecific abdominal complaints. Complications include stone formation, recurrent pyogenic cholangitis, and cholangiocarcinoma. Approximately 35 million people are infected with liver flukes throughout the world and the exceptionally high incidence of cholangiocarcinoma in some endemic areas (e.g., in Korea and Thailand) is closely associated with a high prevalence of liver fluke infection. Lim (2011) reviewed the parasitology, epidemiology, and clinical findings and complications of liver fluke infection. (Lim 2011 and references therein)

The life cycle of C. sinensis involves both a first intermediate snail host and a second intermediate fish host. Embryonated eggs are discharged in the biliary ducts and stool of a human host. An adult fluke lays 2000 to 4000 eggs each day. If these eggs are ingested by a suitable intermediate snail host, the eggs release miracidia, which go through several developmental stages: sporocyst, redia, and cercaria. The cercariae are released from the snail and after a short period of free-swimming time in water, they may come in contact with and penetrate the flesh of a freshwater fish (13 genera are reported to be the most common intermediate fish hosts, all in the family Cyprinidae: Pseudorasbora, Ctenopharyngodon, Mylopharyngodon, Abbottina, Rhodeus, Hemiculter, Sarcocheilichthys, Hemibarbus, Acanthorhodeus, Puntungia, Pseudogobio, Gnathopogon, and Acheilognathus). Here they encyst as metacercariae. Infection of humans occurs by ingestion of undercooked, salted, pickled, or smoked freshwater fish. After ingestion, the metacercariae excyst in the duodenum (first portion of the small intestine) and ascend the biliary tract through the ampulla of Vater (=hepatopancreatic ampulla, where the pancreatic and bile ducts come together). Maturation takes approximately one month. The adult flukes (which measure 10 to 25 mm by 3 to 5 mm) reside in small and medium-sized biliary ducts. In addition to humans, carnivorous animals can serve as reservoir hosts.

(Centers for Disease Control Parasites and Health Website; Kaewkes 2003 and references therein)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographic Range

Clonorchis sinensis is found mainly in eastern Asia and south Pacific Asia. Its common name, Chinese liver fluke, comes from its abundance in these areas. Clonorchis sinensis is distributed over multiple countries, including China, Korea, Vietnam, Taiwan, Japan, and others.

Biogeographic Regions: palearctic (Native ); oriental (Native )

  • Chappell, L. 1979. Physiology of Parasites. New York: John Wiley and Sons.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Egg - The egg is oval-shaped, 26-30 micrometers in length, and has a thick yellow-brown shell surrounding it. The C. sinensis egg has an operculum covering the anterior end with a conspicuous rim that protrudes from the sides of the egg. On the posterior side, each egg has either a small knob or a little curved spine.

Miracidium - This larval stage is ciliated and slightly oval in shape. It has 2 simple eyespots and lateral papillae which protrude outwards and serve as sensory organs.

Sporocyst - The sporocyst resembles a hollow and simple sac. Oftentimes, the developing rediae are visible inside the sac.

Redia - At this larval stage, it retains a very simple worm structure. In some ways, it still resembles a sac. It has a pharynx but no esophagus or intestine. Developing cercariae are visible in the rest of its body.

Cercaria - In this stage, C. sinensis resembles a small adult with a tail, which it loses upon penetration of the second intermediate host. The tail has dorsal and ventral fins on it to aid in locomotion. It is brownish in color. Unlike an adult, it has two eyespots, penetration glands and a stylet at its anterior end, and a cuticle with small spines.

Metacercaria - In this form, C. sinensis is encysted and does not look like a fluke. It has lost larval organs such as the eyespots, the stylet, and the tail. The round cyst has very thick walls and within it, the maturing fluke is visible as are its suckers.

Adult - As an adult, C. sinensis is a very narrow fluke, 10-25 mm. in length, flattened dorsal-ventrally, with Trematode characteristics such as an oral/anterior sucker, a ventral sucker (also known as the acetabulum), no blood circulatory system, and no body cavity. The common genital pore is just anterior to the acetabulum. The fluke is tapered at the anterior end and rounded at the posterior end. The intestine is bifurcated and ends blindly. A thick and elastic cuticle lacks any kind of spines or scales and can either be a translucent gray color or yellow color (due to absorption of bile). When stained on a slide, its branched testes, lobed ovary, and follicular vitellaria are apparent as is the long and convoluted uterus. The pharynx and esophagus are also visible.

Range length: 10 to 25 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Part of the Clonorchis sinensis life cycle takes place in an aquatic habitat. The first intermediate host is always a snail of some sort, mainly Parafossarulus manchouricus and species from the genus Bulinus. "Selection" of the second intermediate host is less host-specific since cercaria are stimulated to swim by shadows and motion. However, since C. sinensis is mainly in specific regions of the world, certain kinds of freshwater fish are normally found to be second intermediate hosts. There are 12 species of fish that are mainly responsible for passing the infection to humans. Some of these fishes include Pseudorasbora parva (in the Japan region) and Ctenopharyngodon idella (in the Canton region).

Because the definitive host can be any kind of fish-eating vertebrate, its life cycle is no longer confined to an aquatic environment and its geographic range has the potential to substantially increase. Possible hosts include humans, reptiles, birds, pigs, dogs, and cats.

Habitat Regions: terrestrial ; freshwater

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; scrub forest

Aquatic Biomes: lakes and ponds; rivers and streams; temporary pools

Wetlands: marsh ; swamp

Other Habitat Features: urban ; suburban ; agricultural ; riparian

  • Brusca, R., G. Brusca. 1990. Invertebrates. Sunderland, Massachusetts: Sunauer Associates, Inc..
  • Buchsbaum, M., R. Buchsbaum, V. Pearse, J. Pearse. 1987. Living Invertebrates. Boston, Massachusetts: Blackwell Scientific Publications.
  • Clay, T., M. Rothschild. 1952. Fleas, Flukes and Cuckoos. New York: The MacMillan Company.
  • Swellengrebel, N., M. Sterman. 1961. Animal Parasites in Man. Princeton: D. Van Nostrand Company, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

The redia is the first stage that actually feeds. It feeds actively on the tissues of the first intermediate host, normally the digestive and reproductive systems.

Clonorchis sinensis is considered a parasite as an adult fluke. It is found in the biliary systems of its hosts, which range from reptiles to humans, absorbing bile as its source of nutrients.

Animal Foods: body fluids

Primary Diet: carnivore (Eats body fluids)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

The first intermediate host is always a snail of some sort, mainly Parafossarulus manchouricus and species from the genus Bulinus. "Selection" of the second intermediate host is less host-specific since cercaria are stimulated to swim by shadows and motion; however, since C. sinensis is mainly found in specific regions of the world, certain kinds of freshwater fish are normally found to be second intermediate hosts, simply due to their naturally occurring populations.

Ecosystem Impact: parasite

Species Used as Host:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

These animals are probably not preyed on directly but are ingested. Egg and larval mortality are high since the parasites often do not reach appropriate hosts.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Bristles and small spines probably act as tactile receptors, and these animals also may have reduced chemoreceptors.

Communication Channels: tactile ; chemical

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

The life cycle is a three host-system: a snail is always the first intermediate host, a freshwater fish is normally the second intermediate host, and there is a wide range of definitive hosts. C. sinensis is hermaphroditic therefore every single sexually mature fluke will produce eggs. Each adult yields a daily production of 4000 eggs for at least six months which are produced by cross-fertilization. The eggs are passed out with the feces of the definitive host. An egg will not hatch until it is ingested by a proper first intermediate host.

Once ingested and in the alimentary canal, a miricidium emerges from the egg. It remains in this stage for only about 4 hours, after which it becomes a sporocyst.

The sporocyst is normally located in the wall of the first intermediate host's intestine. It can be found in other organs as well. In the next 20 days, germinal cells in the sporocyst undergo asexual reproduction to produce a new "generation". Each new organism is a redia and they emerge when they are mature.

Each redia contains germinal cells which will undergo further asexual reproduction. The next "generation" are cercariae (sing. cercaria). It travels to the hepatopancreas of the snail while the cercariae are developing within itself. At some point, though it is not yet entirely known, up to 50 cercariae emerge from the redia's birth pore, still immature.

The cercaria leaves its snail host one month after the initial infection of the snail by the eggs. It emerges due to some sort of stimuli (i.e. light, temperature, pH, humidity) although the specific stimulus is unknown. Upon contact with the second intermediate host, it attaches with its oral sucker and penetrates the host. It loses its tail during this process of penetration. After 35 days of infection, the cercaria encysts under a scale or in a muscle.

The metacercaria remains encysted in various tissues until the second intermediate host is ingested by a vertebrate. Excystation takes place in the duodenum and a juvenile adult fluke emerges.

A juvenile adult reaches the bile ducts within 4-7 hours after ingestion of the intermediate host. From the duodenum, it penetrates the gut wall and is carried to the biliary system via the ampulla of Vater. After one month it matures enough to produce eggs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Clonorchis sinensis is hermaphroditic therefore every single sexually mature fluke will produce eggs. Each adult yields a daily production of 4000 eggs for at least six months which are produced by cross-fertilization. The eggs are passed out with the feces of the definitive host. An egg will not hatch until it is ingested by a proper first intermediate host.

The sporocyst and redia stages asexually reproduce. A juvenile adult reaches the bile ducts within 4-7 hours after ingestion of the intermediate host; from the duodenum, it penetrates the gut wall and is carried to the biliary system via the ampulla of Vater. It will then be one month before it is mature enough to start producing eggs.

Key Reproductive Features: simultaneous hermaphrodite; sexual ; asexual ; fertilization (Internal )

  • Brusca, R., G. Brusca. 1990. Invertebrates. Sunderland, Massachusetts: Sunauer Associates, Inc..
  • Chappell, L. 1979. Physiology of Parasites. New York: John Wiley and Sons.
  • Clay, T., M. Rothschild. 1952. Fleas, Flukes and Cuckoos. New York: The MacMillan Company.
  • Swellengrebel, N., M. Sterman. 1961. Animal Parasites in Man. Princeton: D. Van Nostrand Company, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Clonorchis sinensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGTCTGCGATATGGCTCCTTACTATGGATCATAAGCGTATAGGTGTTATTTATATGATTCTTGGGATCTGGGGTGGATTTTTGGGTCTTGGGTTGAGGTTTCTTATACGAGTGAATTATTTTGATCCTTACTTTAATGTTATTTCATCAGATGTTTATAATTATGTGGTTACTAGGCATGGGGTTGCTATGATTTTTTTCTTCTTGATGCCTGTTCTTGTGGGCGGTTTTGGTAACTACCTGCTGCCTCTGTTACTTGGTTTATCAGATTTGAATTTGCCTCGTTTGAAAGCTCTAAGCGTGTGGTTGTTGGTTCCTTCGGCTGTTTGTTTTAGTCTTAGGATGTATGGTGGTGCTGGGGTTGGGTGGACTTTTTATCCTCCTCTTTCTGCTAGAGATTATAGAGGTTGAGGGGTTGATTTTTTAATGTTTTCGCTTCATTTGGCTGGGTTATCGAGTCTTTTTGGATCTTTGAAATTTATTTGTACAATATGGTCTGCCGCGGATAGGCGGGTGAGGGAACGACACTCTATAATAGTTTGGGCTTATTTGTTTACGTCTATCTTGTTGTTGGGTACGTTGCCTGTTTTAGCTGCTGGTATAACTATGCTTCTTTTTGATCGTAAATTTGGTACAGTGTTTTTTGATCCGTCGGGTGGGGGTGATCCTTTGTTGTTTCAGCATATGTTTTGGTTTTTTGGTCATCCTGAGGTGTATGTGTTAATATTGCCGGGGTTTGGTATGATTAGTCACATTTGTACTACTTTAACAGGTAAAGATTCGTTGTTTGGTTATGGGGGCTTGGTGTTGGCTATGTTTGCTGTAGTTTGTCTGGGTAGGGTGGTTTGAGCTCATCATATGTTTACTGTTGGGCTGGATTTGGGGACTGCTGTTTTTTTTAGCTCGGTTACTATGATTATAGGTGTGCCTACGGGGATCAAGGTTTTTTCATGATTATATATGCTTGCTGGAACTCGGGAGCGTCTATGAGACCCAATCATGTGGTGGATAATCGGGTTTGTGGTGCTTTTCACTATAGGCGGGGTTACTGGGATAGTTCTTTCTGCTTCTGTAATTGATGCCTTGTTTCATGATACTTGGTTTGTTATTGCTCATTTTCATTATGTTTTATCCCTAGGGTCGTTTAGGACGGTTGTTATTTCTGTAATTTGGTGATGACCTGTGTTTACGGGGTATAGCTTAAATAAGTATCTATTGATGGCTCATTGAGGTGTATCGATGACGGGGTTTAATCTCTGTTTTTTTCCTATGCATTTTTTAGGTGTTTATGGGCTTCCACGTCGGGTGTGTTTGTATGAGCCCTGCCTTCAGTGGTTGAATACTTTGTGTAGGATGGGGGCGATTTTTTCGGTTTTCAGTGGGTTTACGCTTATGTATATTGTTTGAGAATCTATGGCTGTTTGTAACCGTGTCATTAATCTGTGGGGCGGGGCTCATGTTGTTTTTAATGTTTTGGTGAATCCGATTGGGGCGCATAGTCCTTATCTTCATTATCCTGTTTGTTGAGTTCCGAGTGAGATTCGACGGTTGGGGGTGTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Clonorchis sinensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Parasitism by C. sinensis has had large, detrimental effects on humans, especially those in areas such as Asia, where eating raw or undercooked fish is a cultural practice. A human host with an average infection will have two or three dozen worms; heavily infected individuals have been found with as many as 20,000 worms. It is found mainly in the biliary system of the liver but it has also been occasionally found in the pancreas. The fluke does not attack the liver or pancreas themselves however it is greatly damaged due to its migration through the biliary system. Erosion of the epithelial lining of bile ducts is common which leads to the development of blockage in the ducts due to the thickening of scar tissue. This erosion plus the effects of the fluke's perforation into the parenchyma of the liver leads to possible disturbance of normal hepatic functions. Experiments have shown that clonorchiasis in rabbits leads to higher levels of potassium and cholesterol in the blood while calcium levels are lowered. Lipid metabolism and hydrolyzing activity are impaired, as well as glycogen synthesis. Blood sugar levels are erratic as rabbits showed signs of hypo- and hyperglycemia.

Eggs and worms that somehow migrate out of the biliary system may become nuclei of eventual gallstones. Metacercariae travelling through the body to the appropriate locations for excystation can cause high fevers in the host.

Negative Impacts: injures humans (causes disease in humans )

  • von Brand, T. 1952. Endoparasitic Animals. New York: Academic Press Inc., Publishers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

It has no known positive effect.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Clonorchis sinensis

Clonorchis sinensis!<-- This template has to be "warmed up" before it can be used, for some reason -->

Clonorchis sinensis, the Chinese liver fluke, is a human liver fluke in the class Trematoda, Phylum Platyhelminthes. This parasite lives in the liver of humans, and is found mainly in the common bile duct and gall bladder, feeding on bile. These animals, which are believed to be the third most prevalent worm parasite in the world, are endemic to Japan, China, Taiwan, and Southeast Asia, currently infecting an estimated 30,000,000 humans.

Contents

Life cycle

An adult Clonorchis sinensis has these main body parts: oral sucker, pharynx, caecum, ventral sucker, vitellaria, uterus, ovary, Mehlis' gland, testes, exretory bladder.
Life cycle of Clonorchis sinensis

The egg of a Clonorchis sinensis (commonly: human liver fluke), which contains the miracidium that develops into the adult form, floats in freshwater until it is eaten by a snail.

First intermediate host

Freshwater snail Parafossarulus manchouricus - synonym: Parafossarulus striatulus, often serves as a first intermediate host for Clonorchis sinensis in China, Japan, Korea and Russia.[1][2]

Other snail hosts include:

Once inside of the snail body, the miracidium hatches from the egg, and parasitically grows inside of the snail. The miracidium develops into a sporocyst, which in turn house the asexual reproduction of redia, the next stage. The redia themselves house the asexual reproduction of free-swimming cercaria. This system of asexual reproduction allows for an exponential multiplication of cercaria individuals from one miracidium. This aids the Clonorchis in reproduction, because it enables the miracidium to capitalize on one chance occasion of passively being eaten by a snail before the egg dies.

Once the redia mature, having grown inside the snail body until this point, they actively bore out of the snail body into the freshwater environment.

Second intermediate host

There, instead of waiting to be consumed by a host (as is the case in their egg stage), they seek out a fish. Boring their way into the fish's body, they again become parasites of their new hosts.

Once inside of the fish muscle, the cercaria create a protective metacercarial cyst with which to encapsulate their bodies. This protective cyst proves useful when the fish muscle is consumed by a human.

Definitive host

The acid-resistant cyst enables the metacercaria to avoid being digested by the human gastric acids, and allows the metacercaria to reach the small intestine unharmed. Reaching the small intestines, the metacercaria navigate toward the human liver, which becomes its final habitat. Clonorchis feed on human bile created by the liver. In the human liver, the mature Clonorchis reaches its stage of sexual reproduction. The hermaphroditic adults produce eggs every 1–30 seconds, resulting in the rapid multiplication of inhabitants in the liver.

Effects on human health

Dwelling in the bile ducts, Clonorchis induces an inflammatory reaction, epithelial hyperplasia and sometimes even cholangiocarcinoma, the incidence of which is raised in fluke-infested areas.[3]

One adverse effect of Clonorchis is the possibility for the adult metacercaria to consume all bile created in the liver, which would inhibit the host human from digesting, especially fats. Another possibility is obstruction of the bile duct by the parasite or its eggs, leading to biliary obstruction and cholangitis (specifically oriental cholangitis).

Central Serous Retinopathy (CSR) a report of 80 cases by Dr. John Chiao-nan Chang, M.D. and Dr. Yin-Ping Wang, M.D. Hong Kong on page 125 of their report observed that 19% of the cases of CSR in their sample tested positive for Clonorchis sinensis.[4]

Treatment

Drugs used to treat infestation include triclabendazole, praziquantel, bithionol, albendazole and mebendazole.[citation needed]

See also

References

  1. ^ Clonorchis sinensis. Web Atlas of Medical Pathology, accessed 1 April 2009
  2. ^ a b c d e f g h i World Health Organization (1995). Control of Foodborne Trematode Infection. WHO Technical Report Series. 849. PDF part 1, PDF part 2. page 125-126.
  3. ^ Kumar et al.: Robbins & Cotran Pathologic Basis of Disease 7E
  4. ^ Report Text
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!