Molecular Biology and Genetics

Molecular Biology

Barcode data: Apamea anceps

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACTTCCCTCAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATCCTTAATTGGCGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTGGGAGCTCCAGATATAGCATTTCCACGAATAAATAATATAAGTTTTTGATTATTACCACCTTCTTTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGCCCATGGAGGAAGTTCTGTAGATTTAGCTATTTTTTCACTTCATTTAGCTGGTATCTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCCTTATTTATTTGAGCTGTAGGAATTACTGCATTTTTATTACTACTATCTTTACCTGTTTTAGCGGGAGCTATTACAATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGACCCTGCAGGAGGGGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apamea anceps

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Apamea anceps

The Large Nutmeg (Apamea anceps) is a moth of the Noctuidae family.

Geography[edit]

The Large Nutmeg is distributed throughout Europe and through the Palearctic to Yakutia, Transbaikalia,Lebanon , Armenia, Asia Minor, Irana, Mongolia East Siberia, China (Shaanxi) and Japan. It is also found in North West Africa.


Description[edit]

See glossary for terms used

The wingspan is 35–40 mm. Forewing grey speckled with darker, and more or less tinged with brown; the veins dark; inner and outer lines double, dark filled in with pale ground colour, conversely lunulate-dentate; the inner line sometimes forming a sharp outward angle below vein 1, meeting the median line, sometimes rounded ami remote from it: claviform brown, darker-edged, variable in size, often quite small; orbicular and reniform pale with dark centres, the latter with white dotted annulus and often followed by a pale patch; marginal area dark grey beyond the pale submarginal line, which is preceded by brownish patches at costa and on both folds: hindwing dirty whitish, with darker cellspot, veins, and outer line, the terminal area diffusely fuscous, with the submarginal line showing paler along termen; in typical sordida the brown tints are confined to the two folds: -in anceps Hbn. these brown tints pervade more or less the whole forewing: - ochracea Tutt has the ground colour paler and the suffusion more rufous brown;renardii Bsd. is a very pale form with the markings subobsolete; while engelhartii Duurloo represents a renardii pale form from E. Jutland with indistinct markings; - ab. mediana ab. nov. [Warren] appears very distinct; the brown grey ground colour is without dark speckling; the inner and outer lines are single, black and distinct, the outer with clear black teeth on the veins; the median shade, generally inconspicuous, is thick and black, distinctly angled outwards on subcostal and veins 1 and 2; the space between it and outer line deeper brown: the markings of the hindwing clearer; the male specimen from Germany without precise locality.[1]

Adults are on wing from June to July.

Larvae[edit]

The larvae feed on the flowers and leaves of various grasses, including Poa annua and Dactylis glomerata.[2]

References[edit]

  1. ^ Seitz, A. Ed., 1914 Die Großschmetterlinge der Erde, Verlag Alfred Kernen, Stuttgart Band 3: Abt. 1, Die Großschmetterlinge des palaearktischen Faunengebietes, Die palaearktischen eulenartigen Nachtfalter, 1914
  2. ^ "Robinson, G. S., et al. 2010. HOSTS - A Database of the World's Lepidopteran Hostplants. Natural History Museum, London.". 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!