Overview

Distribution

non-marine origin (but recorded from the sea)
  • Gibson, D.I. (2001). Acanthocephala, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 176-177
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Animal / parasite / endoparasite
cystacanth of Echinorhynchus clavula endoparasitises Gammarus pulex

Animal / parasite / endoparasite
Echinorhynchus clavula endoparasitises intestine of Gasterosteus aculeatus

Animal / parasite / endoparasite
cystacanth of Echinorhynchus clavula endoparasitises Asellus

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
Acanthocephalus clavula endoparasitises anterior intestine of Perca fluviatilis

Animal / parasite / endoparasite
Acanthocephalus clavula endoparasitises anterior intestine of Rutilus rutilus

Animal / parasite / endoparasite
encapsulated cystacanth of Acanthocephalus clavula endoparasitises haemocoel of Asellus meridianus
Other: sole host/prey

Animal / parasite / endoparasite
Acanthocephalus clavula endoparasitises anterior intestine of Esox lucius

Animal / parasite / endoparasite
Acanthocephalus clavula endoparasitises anterior intestine of Gasterosteus aculeatus

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acanthocephalus clavula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTGATATATATAGTAGTAGGTTTGTGGGGAGGTTTAGTTGGTTTGTCTTTAAGGTTAGTTGTTCGCATGGAGTTAGGGTCTAGGGGCGTTTGACTAGGTGAT---GAGTATTTATATAATATAGTGGTCAGAATACATGGGGTGATGATAGTATTCTTTTTAGTTATACCTTTCATGATGGGCGGTTTTGGGAATTGAATGATTCCTATTATATTAGGGTTAGGGGATATAGCCTTACCTCGTTTAAATAATTTAAGTCTTTTATTACTATTTGCGGCTTTAGGTCTAAGGGGGTTTTCTATGGTTTTAATAGGGGGTGCG---GCTGGGTGGACAATGTACCCTCCCTTAATATTAAAAAGTTTTAGCTCCAGAGTTTCGGTGGATATAATAGTTTTGAGGCTGCATGTAGTGGGTTTATCTTCTATTTTAGGTTCAATCAATATCATTGTAACATTATTTGCCTATTTTTTACAGGGGGGTGGGTTATTACAAACCCCCTTGTTAGTATGAGCAGAGGTGGTTGCTGCGGGGTTAATTTTACTAACTGTACCAGTGTTGGCTGCTGCTTTAACTATAGTGTTATTGGATCGTAATATGGGGACAAGTTATTTTGACCCA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acanthocephalus clavula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!