Overview

Brief Summary

Biology

A sessile mollusc, the small giant clam attaches itself to rocks or dead coral and siphons water through its body, filtering it for phytoplankton, as well as extracting oxygen with its gills. However, it does not need to filter-feed as much as other clams since it obtains most of the nutrients it requires from tiny photosynthetic algae known as zooxanthellae (4). Beginning life as a tiny fertilised egg, the small giant clam hatches within 12 hours, becoming a free-swimming larva. This larva then develops into another, more developed, larva which is capable of filter-feeding. At the third larval stage, a foot develops, allowing the larva to alternately swim and rest on the substrate. After eight to ten days, the larva metamorphoses into a juvenile clam, at which point it can acquire zooxanthellae and function symbiotically (4). The juvenile matures into a male clam after two or three years, becoming a hermaphrodite when larger (at around 15 centimetres in length) (4) (5). Reproduction is stimulated by the lunar cycle, the time of day, and the presence of other eggs and sperm in the water. Hermaphroditic clams will release sperm first, followed by eggs (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

At less than a third of the size of the true giant clam (Tridacna gigas), the small giant clam deserves its name. As an adult, it has a large shell that adheres to a rock by its byssus – a tuft of long, tough filaments that protrude from a hole next to the hinge of the shell. When open, the bright blue, green or brown mantle is exposed and obscures the edges of the shell with its prominent and distinctively furrowed edges. The small giant clam is a bivalve mollusc, referring to the two valves on the mantle. These siphon water through the body to extract oxygen from the water using the gills, and to feed on algae (4). The attractive colours of the small giant clam are the result of pigment cells, which have a crystalline structure inside. These are thought to protect the clam from the effects of intense sunlight, or bundle light to enhance photosynthesis, the energy-producing process carried out by the tiny algae living within (4) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Summary

"Tridacna maxima, commonly called the Small Giant Clam, is a sessile bivalve with the widest range of all Giangt Clam species, and found in the oceans surrounding east Africa, India, China, Australia, Southeast Asia and the islands of the Pacific."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

The small giant clam has the widest range of all giant clam species. It is found in the oceans surrounding east Africa, India, China, Australia, Southeast Asia and the islands of the Pacific (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

"Large shell that adheres to a rock by its byssus, has bright blue, green or brown mantle and distinctive furrows on edges."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: maximum of 20cm.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

SubSpecies Varieties Races

"Tridacna maxima var. fossor Hedley, 1921"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Habitat

Marine: found in shallow water coral reefs in well-lit areas.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1174 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1159 samples.

Environmental ranges
  Depth range (m): 0 - 28
  Temperature range (°C): 24.616 - 28.899
  Nitrate (umol/L): 0.033 - 2.880
  Salinity (PPS): 33.773 - 36.148
  Oxygen (ml/l): 4.497 - 4.866
  Phosphate (umol/l): 0.063 - 0.507
  Silicate (umol/l): 0.950 - 4.026

Graphical representation

Depth range (m): 0 - 28

Temperature range (°C): 24.616 - 28.899

Nitrate (umol/L): 0.033 - 2.880

Salinity (PPS): 33.773 - 36.148

Oxygen (ml/l): 4.497 - 4.866

Phosphate (umol/l): 0.063 - 0.507

Silicate (umol/l): 0.950 - 4.026
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found living on the surface of reefs or sand, or partly embedded in coral (2), the small giant clam occupies well lit areas, due to its symbiotic relationship with photosynthetic algae, which require sunlight for energy production (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeds on algae.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

"Acts as the host for the ectoparasite Anthessius alatus Humes & Stock, 1965. Forms symbiotic associations with tiny photosynthetic zooxanthellae."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

"Sexual maturity: At 2-3 years of age. Reproduction stimuli: Lunar cycles, the presence of other sperms and eggs in the water, the time of the day. Fertilisation: External. Hermaphrodites release sperms first, then eggs."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tridacna maxima

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCATAAAGATATTGGAACTCTTTATTTTTTATTAGCATTGTGGGCAGGGCTGGCAGGTGCGTCGTTTAGAGTAATAATCCGAACAGAATTAGCATGGCCTGCTTCATGGCTGCAGAAT---AATAGACTTTATAATGTAATCGTTACTACACATGCATTAATTATAATTTTTTTTATGGTAATGCCGGTGATAATAGGCGGATTTGGAAATTGACTTGTACCTTTAATAATGGTAATACCAGATATGCATTTCCCTCGATTAAATAATTTGAGGTTTTGGTTTGTACCTAATGCATTTTTTTTGTTAGGAGTATCTGGATTTGTAGAAGGAGGCATGGGTGCTGGTTGAACAATCTACCCCCCACTGACTTCAATCGATTTCTTAAGAGATCCGTCTATAGATCTTGCCATTTTTTCCCTTCACTTAGGCGGTGCCTCATCTATTGCAGCCAGGTTAAATTTTGCAAGGACTGTGGCTAATATACGGCATCAAAAACGTGGTTTCCATAAAATTCCTATGTTTCCAGTGTCATTAGGTATTACAGCGTTGCTTCTTATTGTGGCAATGCCTGTTTTAGCTGGGGCTTTAACCATATTATTATTTGATCGTAATTTTGCTACATCATTTTTTGATCCTGTTGGCGGTGGAGATCCGGTTTTATTTATACATTTATTTTGATTTTTTGGTCAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tridacna maxima

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LR/cd
Lower Risk/conservation dependent

Red List Criteria

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Wells, S.

Reviewer/s

Contributor/s

History
  • 1994
    Insufficiently Known
    (Groombridge 1994)
  • 1990
    Insufficiently Known
    (IUCN 1990)
  • 1988
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"Red List Category & Criteria: Lower Risk/conservation dependent ver 2.3 Year Published: 1996 Annotations: Needs updating Assessor/s: Wells, S."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The small giant clam is classified as Lower Risk / Conservation Dependent (LR/cd) on the IUCN Red List (1) and is listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

A major threat to this species is through over-exploitation by humans.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The small giant clam is collected in small numbers for the shell trade, and it is also eaten (2). In Asia, the muscle of the small giant clam is considered a delicacy, and the Bedouins around the Red Sea also eat this marine invertebrate (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Legislation

Listed in CITES: Yes. Appendix: II. Listed in Wildlife (Protection) Act: Yes. Schedule: 1 Appendix: Part IV(B) Mollusca
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

It has been shown that numbers in protected regions are considerably higher than numbers outside these areas. Research into clam farming, as well as into the ecology, growth rates and reproductive behaviour of the small giant clam is necessary to understand the conservation needs of this species. The Tongan Government gives a limit for the minimum size that can be harvested (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Uses

"In Asia, caught for huma consumption - the muscle of this clam is considered a delicacy. Shells used in pottery glaze and floor tiles."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Maxima clam

The maxima clam (Tridacna maxima), also known as the small giant clam, is a species of bivalve found throughout the Indo-Pacific. They are much sought after in the aquarium trade, as their often striking coloration mimics that of the true giant clam, however the maximas maintain a manageable size, with the shells of large specimen typically not exceeding 20 centimetres (7.9 in) in length.

Different colors clams at the coral reef in Papua New Guinea
Maxima clam on a dome coral

Description[edit]

The small giant clam is less than a third of the size of the true giant clam (Tridacna gigas). As an adult, it has a large shell that adheres to a rock by its byssus, a tuft of long, tough filaments that protrude from a hole next to the hinge of the shell. When open, the bright blue, green or brown mantle is exposed and obscures the edges of the shell which have prominent distinctive furrows. The small giant clam is a bivalve mollusc, referring to the two valves on the mantle. These siphon water through the body in order to extract oxygen from the water using the gills and to feed on algae.[1] The attractive colours of the small giant clam are the result of pigment cells, which have a crystalline structure inside. These are thought to protect the clam from the effects of intense sunlight, or bundle light to enhance photosynthesis, the energy-producing process carried out by the tiny algae living within.[1]

Distribution and habitat[edit]

The small giant clam has the widest range of all giant clam species. It is found in the oceans surrounding east Africa, India, China, Australia, Southeast Asia and the islands of the Pacific.[2] [3]

Found living on the surface of reefs or sand, or partly embedded in coral,[4] the small giant clam occupies well-lit areas, due to its symbiotic relationship with photosynthetic algae, which require sunlight for energy production.[1]

Biology[edit]

A sessile mollusc, the small giant clam attaches itself to rocks or dead coral and siphons water through its body, filtering it for phytoplankton, as well as extracting oxygen with its gills. However, it does not need to filter-feed as much as other clams since it obtains most of the nutrients it requires from tiny photosynthetic algae known as zooxanthellae.[1]

Beginning life as a tiny fertilised egg, the small giant clam hatches within 12 hours, becoming a free-swimming larva. This larva then develops into another, more developed, larva which is capable of filter-feeding. At the third larval stage, a foot develops, allowing the larva to alternately swim and rest on the substrate. After eight to ten days, the larva metamorphoses into a juvenile clam, at which point it can acquire zooxanthellae and function symbiotically.[1] The juvenile matures into a male clam after two or three years, becoming a hermaphrodite when larger (at around 15 centimetres in length). Reproduction is stimulated by the lunar cycle, the time of day, and the presence of other eggs and sperm in the water. Hermaphroditic clams release their sperm first followed by the eggs later, thereby avoiding self-fertilisation.[1]

References[edit]

This article incorporates text from the ARKive fact-file "Maxima clam" under the Creative Commons Attribution-ShareAlike 3.0 Unported License and the GFDL.

  1. ^ a b c d e f Ellis, S. (1998) Spawning and early larval rearing of giant clams (Bivalvia: Tridacnidae). Center for Tropical and Subtropical Aquaculture, 130: 1 - 55.
  2. ^ "IUCN Red List". IUCN Red List. 1996-08-01. Retrieved 2013-08-05. 
  3. ^ Huelsken, T., Keyse, J., Liggins, L., Penny, S., Treml, E.A., Riginos, C. (2013) A Novel Widespread Cryptic Species and Phylogeographic Patterns within Several Giant Clam Species (Cardiidae: Tridacna) from the Indo-Pacific Ocean. PLoS ONE, DOI: 10.1371/journal.pone.0080858.
  4. ^ Wells, S.M., Pyle, R.M. and Collins, N.M. (1983) The IUCN Invertebrate Red Data Book. IUCN, Gland, Switzerland.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!