Physical Description

Type Information

Holotype for Calyptogena elongata Dall, 1916
Catalog Number: USNM 110774
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): United States Fish Commission
Locality: off Pt. Loma, California, United States, North Pacific Ocean
Depth (m): 503 to 503
Vessel: Albatross R/V
  • Holotype: Proc. Biol. Soc. Wash. 52(2183): 408.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calyptogena elongata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGGGCTGGGGTTTTAGGGGAT---AGTCATTTATACCAAGTAGTGGTTACTGCTCACGGGTTATTAATGATTTTTTTCTTAGTAATACCAATAATGATTGGGGGTTTTGGAAATTGGTTGGTACCTTTAATGTTACAGATTCCAGATATGGCTTTTCCACGAATGAATAATTTAAGATTTTGATTATTGCCTAGGTCGGTTTTAATGTTGCTTGGTTCTGCTTATGTGGAAAGTGGAGCGGGTACTGGGTGAACTATTTATCCCCCGTTGTCTAGAGTTATAGGACACGCTGGTCCTTCTGTTGATTTTGTAATTTTATCTCTTCATTTAGGTGGTGTGTCTTCTATTTTAGCTTCTATTAATTTTGTGGTAACTTCTCTTTGCATGCGTGTTGAAGCTTTATCACTATTGCGTGTGACTATATTTGTTTGGTGTGTAGCTGTTACTGGATTTTTGTTAATTATTGCTATACCTGTTTTGGCTGGGAGATTAACAATATTATTAACTGATCGTAAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Calyptogena elongata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!