Physical Description
Type Information
Holotype for Calyptogena elongata Dall, 1916
Catalog Number: USNM 110774
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): United States Fish Commission
Locality: off Pt. Loma, California, United States, North Pacific Ocean
Depth (m): 503 to 503
Vessel: Albatross R/V
Catalog Number: USNM 110774
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): United States Fish Commission
Locality: off Pt. Loma, California, United States, North Pacific Ocean
Depth (m): 503 to 503
Vessel: Albatross R/V
- Holotype: Proc. Biol. Soc. Wash. 52(2183): 408.
© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Calyptogena elongata
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GGGGCTGGGGTTTTAGGGGAT---AGTCATTTATACCAAGTAGTGGTTACTGCTCACGGGTTATTAATGATTTTTTTCTTAGTAATACCAATAATGATTGGGGGTTTTGGAAATTGGTTGGTACCTTTAATGTTACAGATTCCAGATATGGCTTTTCCACGAATGAATAATTTAAGATTTTGATTATTGCCTAGGTCGGTTTTAATGTTGCTTGGTTCTGCTTATGTGGAAAGTGGAGCGGGTACTGGGTGAACTATTTATCCCCCGTTGTCTAGAGTTATAGGACACGCTGGTCCTTCTGTTGATTTTGTAATTTTATCTCTTCATTTAGGTGGTGTGTCTTCTATTTTAGCTTCTATTAATTTTGTGGTAACTTCTCTTTGCATGCGTGTTGAAGCTTTATCACTATTGCGTGTGACTATATTTGTTTGGTGTGTAGCTGTTACTGGATTTTTGTTAATTATTGCTATACCTGTTTTGGCTGGGAGATTAACAATATTATTAACTGATCGTAAT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Calyptogena elongata
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 4
Species With Barcodes: 1
Public Records: 5
Specimens with Barcodes: 4
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
