Overview

Comprehensive Description

General Description

Description: The shell is large, with a valve length of up to 180 mm, and is thin-shelled and strongly elongate in outline. The height/length ratio of the valves is 0.19-0.23, and the shell is nearly equivalve. The periostracum is thin, brownish in colour, and only remains on a narrow peripheral area, with short commarginal elevated lamellae. The shell sculpture consists of very close-set commarginal striae and inconspicuous radial lines that run from the umbo to the posterior margin. The posterior sector of the shell is separated from the middle one by a keel that runs from the umbo to the ventro-posterior margin. The valves are in equilateral, with the umbo situated in the anterior 12-14% of the valve. The umbones are prosogyrate and low. The beaks are not enrolled and touch each other. The anterior-dorsal margin is short and convex. The anterior margin is rounded, whilst the ventral margin is concave. The posterior margin is rounded, but is more tapering than the anterior margin. The posterior-dorsal margin is straight proximally and convex distally. The internal shell surface is white. There is a sulcus running from the umbonal cavity to the anterior most point of the posterior adductor scar, with a row of small pallial scars just above this sulcus. The pallial line is distinct. There are secondary pallial scars in the anterior part of the pallial line that are very well-developed. The pallial sinus is a shallow irregular indentation just below the posterior adductor scar, which also has secondary pallial scars. The anterior adductor scar is ovately conical and impressed. The posterior adductor scar is larger, suboval and impressed towards the front. The anterior pedal retractor scar is deeply impressed, and is located above the anterior adductor scar. The posterior pedal retractor is slightly impressed and fused to the posterior adductor scar. The nymph is long and weak. There is a fibrous layer of ligament that occupies 30-38% of the valve length and 65-76% of the posterior lamellar layer.

Dentition of right valve in adults: There is a ventral cardinal (1) and subumbonal cardinal that consist of only a posterior ramus (3b). Tooth 1 is strong, wedge-shaped and pointed, radiating ventrally. 3b is much lower and radiates posteriorwards. There is no fusion between 1 and 3b, with their ventral parts diverging at <90°.

Dentition of left valve in adults: The subumbonal cardinal tooth has two rami (2a and 2b). The posterodorsal cardinal tooth (4b) is very inconspicuous, sometimes absent.. The 2b-ramus is the most developed, and is upright and radiates posteriorwards. The 2a-ramus is lower, sometimes reduced and thinner. The proximal part of 2a is connected with the lateral surface of 2b by a low bridge, with the ventral parts diverging at about 90°.

Dentition of right valve in juvenile of shell length 20.2 mm: The ventral cardinal tooth (1) is most developed, upright and shelf-like, and is nearly parallel to the dorsal margin of the shell. The subumbonal tooth has a very short anterior ramus 3a, which is completely reduced in adults. Ramus 3b is shelf-like, radiating posteriorwards. Behind 3b there is a thickening on the nymph that is separated from the posterior part of the nymph by a shallow furrow that radiates posteriorwards.

Dentition of left valve in juvenile: The 2a-ramus is shelf-like and parallel to the anterior-dorsal shell margin,. It is fused in its proximal part with the proximal part of the thicker 2b-ramus, which is also parallel to the posterior-dorsal shell margin. Tooth 4b is nearly totally reduced, and looks like a slight ridge that radiates posteriorly.

(Krylova et al., 2010).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

North Pacific Ocean: Japan Trench, 5,400-6,400 m, Kurile Trench, 4,700-6,200 m, Aleutian Trench, 4,550-6,400 m (Krylova et al., 2010).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 7 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 3300 - 6181
  Temperature range (°C): 1.536 - 1.598
  Nitrate (umol/L): 36.420 - 37.110
  Salinity (PPS): 34.678 - 34.691
  Oxygen (ml/l): 3.451 - 3.727
  Phosphate (umol/l): 2.581 - 2.586
  Silicate (umol/l): 146.513 - 162.958

Graphical representation

Depth range (m): 3300 - 6181

Temperature range (°C): 1.536 - 1.598

Nitrate (umol/L): 36.420 - 37.110

Salinity (PPS): 34.678 - 34.691

Oxygen (ml/l): 3.451 - 3.727

Phosphate (umol/l): 2.581 - 2.586

Silicate (umol/l): 146.513 - 162.958
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 35 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 3547 - 5347

Graphical representation

Depth range (m): 3547 - 5347
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Abyssogena phaseoliformis occurs at cold seeps that are situated at the lower slope of convergent continental margins close to the trench axis (Krylova et al., 2010).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calyptogena phaseoliformis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGTGCGGGG---GTTCTAGGTGAT---AGTCATTTATATCAGGTAGTAGTTACTGCACATGGATTATTAATGATTTTTTTTTTAGTAATACCAATAATAATTGGAGGTTTTGGAAATTGATTATTCCCTTTAATGTTGCAAATCCCTGATATACCTTTCCCCCGAATAAATAATTTAAAATTTTGGTTGATACCTAGGTCAGTTTTAATGTTACTTGGTTCTGCTTATGTAGAAAGTGGGGCAGGTACTGGTTGAACTATTTATCCTCCATTATCTAGTATTATAGGTCATGCTGGTCCTTCTGTAGATTTTGTGATTTTATCTCTTCATTTAGGTGGTGTATCTTCTATTTTGGCCTCTATTAATTTTGTAGTTACTTCTCTTTGTATGCGTGTTGAAGCTTTATCTTTATTACGTGTAACTATATTTGTTTGATGTGTTGCTATTACTGGTTTTTTATTAATTATTGCTATACCGGTTTTAGCTGGGAGATTAACAATATTATTAACTGATCGTAAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Calyptogena phaseoliformis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!