Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 3806.5 - 3840
  Temperature range (°C): 1.536 - 1.536
  Nitrate (umol/L): 37.110 - 37.110
  Salinity (PPS): 34.678 - 34.678
  Oxygen (ml/l): 3.451 - 3.451
  Phosphate (umol/l): 2.586 - 2.586
  Silicate (umol/l): 146.513 - 146.513

Graphical representation

Depth range (m): 3806.5 - 3840
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calyptogena kaikoi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTGCGGGGGTTTTAGGTGAT---AGTCATTTATATCAGGTAGTAGTCACTGCACATGGGTTATTAATGATTTTTTTCTTAGTAATACCTATGATGATTGGGGGCTTTGGAAATTGATTAGTTCCTTTAATGTTACAAATTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGATTTTGGTTGATGCCTAGGTCAGTTTTAATGCTACTTGGTTCTGCTTATGTAGAAAGTGGGGCAGGTACTGGTTGAACTATTTATCCCCCATTATCTAGTATTATGGGTCATGCTGGTCCTTCTGTAGACTTTGTGATTTTATCTCTTCATTTAGGTGGTGTGTCTTCTATTTTAGCTTCTATTAATTTTGTAGTTACTTCTCTTTGTATACGTGTTGAAGCTTTATCTTTATTACGTGTAACTATATTTGTTTGATGTGTTGCTATTACTGGTTTTTTATTAATTATTGCTATACCGGTTTTAGCTGGGAGATTAACAATATTATTAACTGATCGTAAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Calyptogena kaikoi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!