Ecology
Habitat
Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.
Environmental ranges
Depth range (m): 3806.5 - 3840
Temperature range (°C): 1.536 - 1.536
Nitrate (umol/L): 37.110 - 37.110
Salinity (PPS): 34.678 - 34.678
Oxygen (ml/l): 3.451 - 3.451
Phosphate (umol/l): 2.586 - 2.586
Silicate (umol/l): 146.513 - 146.513
Graphical representation
Depth range (m): 3806.5 - 3840
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 2 samples.
Environmental ranges
Depth range (m): 3806.5 - 3840
Temperature range (°C): 1.536 - 1.536
Nitrate (umol/L): 37.110 - 37.110
Salinity (PPS): 34.678 - 34.678
Oxygen (ml/l): 3.451 - 3.451
Phosphate (umol/l): 2.586 - 2.586
Silicate (umol/l): 146.513 - 146.513
Graphical representation
Depth range (m): 3806.5 - 3840
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Calyptogena kaikoi
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GGTGCGGGGGTTTTAGGTGAT---AGTCATTTATATCAGGTAGTAGTCACTGCACATGGGTTATTAATGATTTTTTTCTTAGTAATACCTATGATGATTGGGGGCTTTGGAAATTGATTAGTTCCTTTAATGTTACAAATTCCTGATATAGCTTTTCCTCGAATAAATAATTTAAGATTTTGGTTGATGCCTAGGTCAGTTTTAATGCTACTTGGTTCTGCTTATGTAGAAAGTGGGGCAGGTACTGGTTGAACTATTTATCCCCCATTATCTAGTATTATGGGTCATGCTGGTCCTTCTGTAGACTTTGTGATTTTATCTCTTCATTTAGGTGGTGTGTCTTCTATTTTAGCTTCTATTAATTTTGTAGTTACTTCTCTTTGTATACGTGTTGAAGCTTTATCTTTATTACGTGTAACTATATTTGTTTGATGTGTTGCTATTACTGGTTTTTTATTAATTATTGCTATACCGGTTTTAGCTGGGAGATTAACAATATTATTAACTGATCGTAAT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Calyptogena kaikoi
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
