Overview

Comprehensive Description

General Description

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)


Head with deep lateral, longitudinal furrows. Proboscis usually with three muscular layers and muscular crossings.


Caudal cirrus present in perfect specimens, but often missing. Body long and flat, with thin lateral margins. Swims readily. Dorso-ventral and diagonal muscles well developed. Eyes usually absent.

Large and ribbon-like. Slaty brown to grayish green, with thin, white, lateral margins.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 8 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 66
  Temperature range (°C): -1.581 - 10.151
  Nitrate (umol/L): 6.725 - 22.429
  Salinity (PPS): 31.893 - 32.101
  Oxygen (ml/l): 6.228 - 6.561
  Phosphate (umol/l): 0.943 - 2.051
  Silicate (umol/l): 15.658 - 49.447

Graphical representation

Depth range (m): 0 - 66

Temperature range (°C): -1.581 - 10.151

Nitrate (umol/L): 6.725 - 22.429

Salinity (PPS): 31.893 - 32.101

Oxygen (ml/l): 6.228 - 6.561

Phosphate (umol/l): 0.943 - 2.051

Silicate (umol/l): 15.658 - 49.447
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cerebratulus marginatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TCCGGGTTKGTAGGAACTGGTTTAAGGATGTTGATTCGTGCTGAGTTAGGGCAGCCAGGTGCTCTTTTGGGCGAT---GATCATCTCTATAATGTTATTGTAACGGCGCATGCTTTTGTTATGATTTTTTTTCTTGTTATGCCAGTAATGATTGGGGGGTTTGGAAATTGGCTTGTTCCTCTGATGTTGGGGGCCCCTGATATGGCTTTCCCTCGTATAAATAATATGAGGTTTTGGCTTTTGCCTCCGGCTTTAACTTTGTTATTGGGTTCTGCTGCCGTGGAGGGTGGCGCGGGGACGGGGTGAACAGTGTATCCCCCGTTGTCTGGTAATGTGGCCCATGCTGGGGGGTCGGTTGATTTGGCAATTTTTTCTTTACATTTGGCTGGTGTTTCGTCTATTTTGGGAGCAATTAATTTTATTACTACTGTGATTAATATGCGTTGGCGGGGGCTCCAGTTTGAGCGGTTGCCTCTTTTTGTGTGGTCAGTTAAGATTACTGCTATTTTGCTGCTTTTATCTCTGCCGGTGTTGGCGGGGGCAATTACTATGTTGTTGACGGATCGTAATTTTAATACGTCTTTTTTCGAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cerebratulus marginatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!