Ecology

Habitat

Depth range based on 12 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 33 - 100
  Temperature range (°C): 16.368 - 19.203
  Nitrate (umol/L): 0.729 - 11.627
  Salinity (PPS): 35.776 - 37.582
  Oxygen (ml/l): 3.268 - 5.465
  Phosphate (umol/l): 0.091 - 0.841
  Silicate (umol/l): 2.723 - 4.348

Graphical representation

Depth range (m): 33 - 100

Temperature range (°C): 16.368 - 19.203

Nitrate (umol/L): 0.729 - 11.627

Salinity (PPS): 35.776 - 37.582

Oxygen (ml/l): 3.268 - 5.465

Phosphate (umol/l): 0.091 - 0.841

Silicate (umol/l): 2.723 - 4.348
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dispersal

Depth range

below littoral
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pecten jacobaeus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACTATATATCTAATGTTGGGGATGTGGTCGGGTTTTGGGGGTTTAAATCTTAGTTGGATAATGCGTTTAGAGCTAAGGCGGCCAGGAATGTGGTTACCTAGG---TCTGAAGTATACAATGGTATTGTTACTTTACATGCTATTATGATGATTTTTTCCTTTGTTATGCCAGTGCTTATTGGTGGTTTTGGGAATTGGTTGTTGCCTATAATACTAGGTTCAATTGATATGAGTTTTCCTCGGCTTAATACGTTTAGTTTTTGAGTTCTTCCTCCTGCTCTTTATTTAGTGATTGTTTCTTGTTTTATCGACTATGGCAGAGGAACTGGGTGGACTATGTATCCGCCTTTGTCTAGGACTCCTTATTCTGGTGGAATCAGAACTGATTTGATGATTTTGGGGCTTCATTTGGCGGGGATTAGTTCTTCGGCTGAATCTATTAACTATTTAGTCACTTTCTTAAATGTGCGAAGTAAGTCTTTTAAGGCTGAATTTTCCCCTCTTTTCGTGTGGGCTCTGGCTGTCACTAGTTTTTTATTATTGGTGTCTTTGCCTGTATTGGCTGGTGGGTTAACTATACTGATTATAGATCGGGATTTTAACTGTAGGTTCTTTGACCCTTCGGGAGGAGGAGATCCTGTTTTATTCCAACACCTTTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pecten jacobaeus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pecten jacobaeus

Pecten jacobaeus is a species of scallop, an edible saltwater clam, a marine bivalve mollusc in the family Pectinidae, the scallops.

This species appears to be endemic to the Mediterranean Sea, but it may in fact be conspecific with Pecten maximus, the great scallop, which has a larger distribution.[1]

These scallops eat planktonic organisms and other floating food particles, which they obtain by filtering sea water with their gills.

Scallops of this species are collected commercially for human consumption using such techniques as the Rapido trawl.[2]

In a Christian context, this species is considered to be the scallop which is traditionally associated with Saint James, also known as James, son of Zebedee, also known as Saint Jacob, hence the specific name jacobaeus. It is also known as the "Pilgrim's scallop".[3]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!