Overview

Brief Summary

The pectinid scallop Pedum spondyloideum occurs almost exclusively on massive coral colonies of the genus Porites. These scallops have reduced the effects of recent heavy levels of predation by the starfish Acanthaster planci on their coral hosts on the Great Barrier Reef. Scallops repel foraging starfish and other echinoderms on contact by repeated expulsion of jets of water. In coral populations subject to heavy predation pressure, this paramutualistic behavlour has resulted in significantly greater survival of host Porites in comparison with congeners without scallops. The survival of corals protected by scallop populations may be important in enhancing recovery and preserving the population structures of these long-lived species. The scallop's expellent water jets function primarily in the removal of wastes. Pedum spondyloideum's secondary application of the jets against A. planci and other foraging organisms may thus exemplify an exapted means of host defence. (DeVantier and Endean, 1988.)

Creative Commons Attribution 3.0 (CC BY 3.0)

© Jennifer Hammock

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 61 specimens in 1 taxon.
Water temperature and chemistry ranges based on 60 samples.

Environmental ranges
  Depth range (m): 2 - 46
  Temperature range (°C): 23.980 - 28.860
  Nitrate (umol/L): 0.047 - 0.311
  Salinity (PPS): 34.090 - 34.992
  Oxygen (ml/l): 4.501 - 4.820
  Phosphate (umol/l): 0.067 - 0.222
  Silicate (umol/l): 1.108 - 2.541

Graphical representation

Depth range (m): 2 - 46

Temperature range (°C): 23.980 - 28.860

Nitrate (umol/L): 0.047 - 0.311

Salinity (PPS): 34.090 - 34.992

Oxygen (ml/l): 4.501 - 4.820

Phosphate (umol/l): 0.067 - 0.222

Silicate (umol/l): 1.108 - 2.541
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dispersal

Depth range

littoral-below littoral
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pedum spondyloideum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTATTGCCTTTATTATTGGGGGGTATTGACATAAGGTTTCCCCGGGTAAATACTTTTAGATTTTGGGTGGTACCTGCTGCGTTGTATATGGTAGTTGTGTCGCCTTTTATTGAAGAAGGAAGTGGGACGGGGTGGACTATATATCCGCCTTTGTCTTCTACCCCGTATCAAAGGGATATTTGTACGGACATGGTAATTTTGGGACTGCACTTGGCTGGTGTAAGTTCTTCTGCTGCTTCTATTAATTATTTAGCGACCTTCTTAAACATACGAGGAAAATCTTATAAGGCTGAGTTTTGTCCTCCTTTTGTTTGGGCTTTATCGGTAACAAGGTTTTTATTATTAGTGTCTCTTCCTGTTTTAGCTGGTGGTTTAACTATATTAATTTTAGACCGTCATTTTAATTGTAGGTTTTTTGATCCTGCTGGGGGTGGTGACCCTGTTTTATTCCAACATCTTTTCTGGTTTTTCGGGCACCCTGAGGTTTATGTGCTTATTCTTCCCGGATTTGGTTTGGTGTCTCATGTGCTGGTTTTTTACACTAAGAAAATTCGGGTTTTTGGGTCGGTTGCTATAATGTATGCTATAATTTCTATTGGTATTTTAGGGTTTATTGTTTGGGGTCATCATATGTTCACAGTGGGGTTAGATGTGGACACTCGTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pedum spondyloideum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 4 specimens with morphological vouchers housed at Museum of Tropical Queensland and Ocean Genome Legacy
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!