Ecology

Habitat

Depth range based on 61 specimens in 1 taxon.
Water temperature and chemistry ranges based on 60 samples.

Environmental ranges
  Depth range (m): 2 - 46
  Temperature range (°C): 23.980 - 28.860
  Nitrate (umol/L): 0.047 - 0.311
  Salinity (PPS): 34.090 - 34.992
  Oxygen (ml/l): 4.501 - 4.820
  Phosphate (umol/l): 0.067 - 0.222
  Silicate (umol/l): 1.108 - 2.541

Graphical representation

Depth range (m): 2 - 46

Temperature range (°C): 23.980 - 28.860

Nitrate (umol/L): 0.047 - 0.311

Salinity (PPS): 34.090 - 34.992

Oxygen (ml/l): 4.501 - 4.820

Phosphate (umol/l): 0.067 - 0.222

Silicate (umol/l): 1.108 - 2.541
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dispersal

Depth range

littoral-below littoral
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pedum spondyloideum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTATTGCCTTTATTATTGGGGGGTATTGACATAAGGTTTCCCCGGGTAAATACTTTTAGATTTTGGGTGGTACCTGCTGCGTTGTATATGGTAGTTGTGTCGCCTTTTATTGAAGAAGGAAGTGGGACGGGGTGGACTATATATCCGCCTTTGTCTTCTACCCCGTATCAAAGGGATATTTGTACGGACATGGTAATTTTGGGACTGCACTTGGCTGGTGTAAGTTCTTCTGCTGCTTCTATTAATTATTTAGCGACCTTCTTAAACATACGAGGAAAATCTTATAAGGCTGAGTTTTGTCCTCCTTTTGTTTGGGCTTTATCGGTAACAAGGTTTTTATTATTAGTGTCTCTTCCTGTTTTAGCTGGTGGTTTAACTATATTAATTTTAGACCGTCATTTTAATTGTAGGTTTTTTGATCCTGCTGGGGGTGGTGACCCTGTTTTATTCCAACATCTTTTCTGGTTTTTCGGGCACCCTGAGGTTTATGTGCTTATTCTTCCCGGATTTGGTTTGGTGTCTCATGTGCTGGTTTTTTACACTAAGAAAATTCGGGTTTTTGGGTCGGTTGCTATAATGTATGCTATAATTTCTATTGGTATTTTAGGGTTTATTGTTTGGGGTCATCATATGTTCACAGTGGGGTTAGATGTGGACACTCGTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pedum spondyloideum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 4 specimens with morphological vouchers housed at Museum of Tropical Queensland and Ocean Genome Legacy
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!