Overview

Comprehensive Description

Summary

Crassostrea belcheri is a commercial bivalve found along Indian coasts.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

"Shell oblong; margin narrow anteriorly and broad posteriorly; thick lower valve; thin, flat, opercular upper valve; white and glossy inner valves; heart-shaped and pearly white muscle scar."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Holotype for Ostrea benefica Bartsch, 1945
Catalog Number: USNM 254517
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): P. Bartsch
Locality: British North Borneo, Sandakan
  • Holotype: Smithson. Misc. Collns. 104(16): 1, pl. 1,2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Crassostrea bilineata
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

General Habitat

"In low tide zone of estuaries and backwaters, till depths of upto 5-7m."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

"Feeds on diatoms (predominantly species of Coscinodiscus, Thalassiosira, Biddulphia, Cocconeis, Achnanthes, Diploneis and Synedra) and detritus."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Parasites: Pinnotheres sp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Adults dioecious. Spawning in India occurs in the monsoons between July to September.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Crassostrea belcheri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 28 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAAGGTTTTACATAGTATTTGGATTTTGAGCTGTTCTTGCTGGAACAAGATTCAGATCTCTTATTCGTTGAAGGTTGTATAACCCAGGAGCTAAGTTTTTAGAT---CCTGTTACTTATAACGCAGTTGTAACTAGTCATGCATTAGTTATGATTTTTTTCTTTGTTATGCCAGTGATAATTGGCGGGTTCGGTAATTGACTTATTCCTCTAATGCTTCAAGTTGCGCATATGCAATTTCCTCGACTTAATGCATTTAGGTTCTGAGTATTACCGGGATCGCTTTATCTTATACTTATATCTAATCTTGTAGAAAATGGGGTGGGGGCAGGATGAACAATCTACCCTTCTCTATCAACTTACTCCTATCAC---GGGGTTTGCATGGATCTTGCAATTTTGAGACTACATCTGGCGGGTATTAGTTCTATTTTCAGATCAATTAACTTCATAGTAACCATACTGAATATGCGATCTGTAGGG------GGCCACCTGTTAGCACTATTCCCATGGTCTATTAAAGTTACTTCATTTCTGCTTTTAACCACTCTTCCAGTTTTAGCTGGGGGCCTTACGATGCTTTTAACTGACCCGCATTTTAATACATCTTTTTTTGATCCTGTCGGAGGAAGTGACCCTATTTTATTTCAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Crassostrea belcheri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 28
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Not evaluated by IUCN redlist.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Legislation

Listed in CITES: No. Listed in Wildlife (Protection) Act: No
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Uses

Sold in large amounts for human consumption.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!