Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Brief Summary

Native to the Parana river drainage of South America, the small, brown Argentine ant Linepithema humile has spread to become a highly destructive invasive species around the world, forming super colonies especially in warm climates, island environments (for example, New Zealand) and areas where humans have caused environmental disturbances. These small (workers are 2-3 mm long) ants are easily spread accidentally in human transport of goods, and are successful due to their generalist and omnivorous habits. Argentine ant workers forage on nectar, as well as other insects, and effectively displace native species of ants. A significant part of the Argentine ant diet comes from the hemipteran, mealybugs, scale and aphid honeydew and the ants readily protect these insects to take advantage of this food source. Because of this mutalistic relationship, the Argentine ant has indirectly become a threat to crops, which are damaged by boosted pest populations. Although Argentine ants do not bite or sting or directly threaten humans, this highly mobile, gregarious and difficult to control species is tolerant of diverse conditions and food, posing a severe threat to the ecosystems and biodiversity of the countries it invades, and is considered among the worst 100 of the world’s invasive species.

(CABI 2011; Daugherty and Hung; Lowe, Browne and Boudjelas 2000; Wikipedia 2011)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Comprehensive Description

The Argentine ant, Linepithema humile, is among the world’s most notorious, successful and well-studied invasive ant species. Linepithema humile is a nondescript, soft-bodied, small (2.2–2.6 mm), dull light to dark brown ant with large inset eyes. The species is native to the Paraná River drainage in South America, which stretches across northern Argentina, Uruguay, Paraguay, and southern Brazil (Wild, 2004). Linepithema humile thrives in Mediterranean climates, and over the past century it has spread to across the globe by human-mediated transport to Chile, western and southern North America, Hawaii, New Zealand, Easter Island, Australia, Japan, Africa, and southern Europe (Suarez et al., 2001; Wetterer et al., 2009). Argentine ants are significant pests, and are documented to cause substantial harm to native arthropod communities (Cole et al., 1992; Rowles & O'Dowd, 2009a), vertebrate communities (Suarez & Case, 2002; Suarez et al., 2005), plant communities (Christian, 2001; Ives et al., 2011; Lach, 2005; Rowles & O'Dowd, 2009b). Argentine ants are also significant agricultural pests (Vega & Rust, 2001)and urban/residential pests (Klotz et al., 2008a; Klotz et al., 2008b). 

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Antkey

Source: Antkey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Taxonomic History

1 subspecies

Hypoclinea humilis Mayr, 1868b PDF: 164 (w.) ARGENTINA. AntCat AntWiki

Taxonomic history

Forel, 1908 PDF: 395 (m.); Newell, 1908: 28 (q.); Wheeler & Wheeler, 1951 PDF: 186 (l.); Crozier, 1969a PDF: 250 (k.).
Combination in Linepithema (Iridomyrmex): Mayr, 1870b PDF: 959; in Iridomyrmex: Emery, 1888d PDF: 386; in Linepithema: Shattuck, 1992a PDF: 16.
Senior synonym of Linepithema arrogans, Linepithema riograndensis: Wild, 2004 PDF: 1207.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Native range. Paraná River drainage in South America.


Introduced range. Chile, western and southern North America, Hawaii, New Zealand, Easter Island, Australia, Japan, Africa, and southern Europe.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Antkey

Source: Antkey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Wild, A. L., 2004:
 (Worker, Figs. 1 and 5; queen, Figs. 8, 9, and 10; male, Figs. 11, 12, and 13)
 Hypoclinea humilis Mayr 1868: 164. Worker description.
 Iridomyrmex humilis (Mayr); Emery 1888: 386-388. First combination in Iridomyrmex .
 Iridomyrmex humilis (Mayr); Wheeler 1913: 27-29. Male and queen description, worker redescription.
 Iridomyrmex humilis (Mayr); Newell and Barber 1913: 38-39 (egg), 40-41 (larva), 42-45 (worker, male, queen pupae).
 Iridomyrmex humilis variety arrogans Chopard 1921: 241-245. Syn. Nov. Junior synonym of I. humilis by Bernard 1967: 251. Restored to subspecies of L. humile by Shattuck 1992: 16.
 Iridomyrmex riograndensis Borgmeier 1928: 64. Syn. Nov.
 Iridomyrmex humilis (Mayr); Wheeler and Wheeler 1951: 186-189. Summary of larval biology.
 Linepithema riograndense (Borgmeier) ; Shattuck 1992: 16.
 Linepithema humile (Mayr); Shattuck 1992: 16. First combination in Linepithema .
 Type Material Examined
 Additional Material Examined
 South American material examined given in Table 1. Specimens collected outside of South America are listed below. Given the large quantity of Argentine ants collected in California, I only list here a representative subsample of California specimens that were given a relatively thorough examination under the microscope (e.g., setal counts and measurements).
 AUSTRALIA. Sydney [MZSP];Victoria (s. loc.) [BMNH].BELGIUM. Bruxelles Capitale: Brussels [BMNH, NHMB],Brussels Botanical Garden [MHNG].BERMUDA. Bermuda (s. loc.) [BMNH].CAMEROON. Centre-Sud: Nkoemvom [bMNh].FRANCE. Provence-Alpes-Co te d'Azur: Cannes [MCZC, NHMB],Castellane [BMNH],Hyeres [BMNH],Ste. Maxime [NHMB];Midi-Pyrenees: Toulouse [IFML].GERMANY. Berlin: Botanical Garden[MHNG].ITALY. Campania: nr. Naples [BMNH];Liguria: San Remo [NHMB];Sicilia: Palermo[BMNH];Toscana: Monte Argentario Giannella [BMNH],Orbetello [BMNH];Varazze (Savona) [MZSP].LESOTHO. Maseru: Maseru [BMNH]. MO- ROCCO. Tanger, Tangier [USNM].MEXICO. Baja California: Ensenada,Cortera FR [AVSC];Baja California Sur: Guerrero Negro [AVSC];Distrito Federal: Mexico City [BMNH],Distrito Federal (s.loc.) [WPMC].NAMIBIA. Erongo: Swakopmund [BMNH].POLAND. Dolnoslaskie: Breslau [NMHB].PORTUGAL. Faro: Algarve,Luz nr. Lagos [bMNh];Lisboa: Cascais [USNM],Estoril [USNM],Lisbona [MCZC, NHMB],Mafra [USNM],Praia das Macas [USNM];Madeira: Funchal [MCZC, NHMB],Porto Moniz [BMNH],RibeiraBrava [BMNH],Ilheu Chao [BMNH],Porto Santo [BMNH],Sao Vicente [BMNH],Vale de Paraiso [BMNH],Praia Formosa [BMNH],Porto da Cruz [BMNH],Feiteiras [BMNH],Caramujo [BMNH],Lower Levada [BMNH],Madeira Is. (s. loc.) [BMNH, MHNG, NHMB];Porto: Leca [BMNH],Oporto [BMNH].SOUTH AFRICA.Eastern Cape: Queenstown [BMNH],Somerset East [BMNH];Mpumalanga: Nelspruit[BMNH];Northern Cape: Colesberg [ALWC];Western Cape: Capetown [BMNH],Table Mt. [BMNH],nr. George [BMNH].SPAIN. Andalucia: Malaga [USNM];Canarias: Arenara [BMNH],Cruz de Tejeda [BMNH],Gran Canaria, Las Palmas, Telde [BMNH, MCZC, USNM],Orotava [BMNH],Santa Brigida [BMNH],Tenerife, Agua Mansa [NHMB],Tenerife, Ladera de Guimar [BMNH],Tenerife, Volcan de Guimar [NHMB],Tenerife (s. loc.) [BMNH];Cataluna: Playa de Aro [NHMB];Galicia: Mte. Ferro b. Bayona [BMNH];IslasBaleares: Minorca, CalaForcat[BMNH].UNITED KINGDOM. Edinburgh: Edinburgh[BMNH];Sussex: Lewes [BMNH];Eastborne[BMNH];Exeter [BMNH];Windsor [BMNH];Glasgow [BMNH];W. Maidstone, Kent [bMNh];Chillingham [BMNH];Farnham House Lab, Imperial Bureau of Entomology [BMNH].UNITED STATES. Alabama: Lowdnes Co., Ft. Deposit [USNM];California: Alameda Co., Berkeley [UCDC, USNM];Humboldt Co., Redway [ALWC];Los Angeles Co., Pasadena[MZSP, USNM], Monterrey Co., Big Sur [ALWC];Orange Co., Bolsa Chica Marsh [MZSP];Riverside Co., Lake Skinner Camp [AVSC];Sacramento Co., Sacramento [UCDC];San Diego Co., UC Elliot Reserve [AVSC];San Diego Co., San Diego [UCDC];San Diego Co., E. San Diego [UCDC];San Diego Co., Pacific Beach [UCDC];San Diego Co., Mission Hills [UCDC];San Diego Co., Kate Sessions Park [UCDC];San Diego Co., Balboa Park [UCDC];San Diego Co., Point Loma [UCDC];San Joachin Co., Caswell State Park [PSWC];San Luis Obispo Co., Oso Flaco Lake [LACM];San Mateo Co., Colma [USNM];San Mateo Co., San Bruno Mt. [PSWC];Santa Clara Co., South Coyote [PSWC];Sonoma Co., Russian R. 6k E. Healdsburg [UCDC];Yolo Co., 6kW Capay [PSWC];Yolo Co., Davis [PSWC, UCDC];Yolo Co., Grasslands Regional Park, 8k SW Davis [PSWC, UCDC];Florida: Escambia Co., Gonzalez [MCZC];Louisiana: Plaquemines Co., Happy Jack [BMNH], Orleans Co., New Orleans [BMNH], Lousiana (s. loc.) [BMNH];Mississippi: Coahoma Co., Clarkesdale [USNM], Copiah Co., Hazelhurst [MCZC], Oktibbeha Co., Starkville [BMNH];South Carolina: York Co., York [BMNH].
  . 1-7. Linepithema workers. 1. L. humile , lateral view. Specimen from Neembucu, Paraguay. 2. Undescribed Linepithema species, mesosoma, lateral view. Specimen from Parque Nacional El Palmar, Entre Rios, Argentina. 3. L. iniquum , mesosoma, lateral view. Specimen from the Reserva Natural del Bosque Mbaracayua, Paraguay. 4. Undescribed Linepithema species, mesosoma, lateral view. Specimen from the Reserva Natural del Bosque Mbaracayu, Canindeyu, Paraguay. 5. L. humile , head, full face view, same specimen as 1. 6. L. oblongum , head, full face view. Specimen from Infiernillos, Tucumaan, Argentina. 7. Undescribed Linepithema species, head, full face view. Same specimen as in Fig. 2.
 Worker Measurements. HOLOTYPE: HL 0.74, HW 0.66, MFC 0.16, SL 0.76, FL 0.65, LHT 0.68, PW 0.45, ES 2.93, SI 115, CI 89.
 Others (n = 81): HL 0.62-0.78, HW 0.53-0.72, MFC 0.14-0.18, SL 0.62-0.80, FL 0.52-0.68, LHT 0.57-0.76, PW 0.35-0.47, ES 1.98-3.82, SI 108-126, CI 84-93.
  Worker Diagnosis. A large (HL> 0.62 mm) slender Linepithema . Head in full-face view longer than broad (CI 84-93), narrowed anteriorly and reaching its widest point just posterior to the compound eyes. Lateral margins broadly convex, grading smoothly into posterior margin. Posterior margin of head straight in smaller workers to weakly concave in larger workers. Compound eyes large (ES 1.98-3.82), comprising 82- 110 ommatidia (normally around 100). Antennal scapes long (SI 108-126), as long or slightly longer than HL and easily surpassing posterior margin of the head in full-face view. Maxillary palpi relatively short, segments 4 and 5 both noticeably shorter than segment2.
 Pronotum and mesonotum forming a continuous convexity in lateral view, mesonotal dorsum nearly straight, not angular or strongly impressed, although sometimes with a slight impression in the anterior half.
 Metanotal groove moderately impressed. Propodeum in lateral view inclined anteriad. In lateral view, dorsal propodeal face meeting declivity in a distinct though obtuse angle, from which the declivity descends in a straight line to the level of the propodeal spiracle.
  Dorsum of head, mesosoma, petiole, and abdominal tergites 3 and 4 (= gastric tergites 1 and 2) devoid of erect setae (very rarely with a pair of small setae on abdominal tergite 4). Clypeus bearing a pair of long, forward-projecting setae. Abdominal tergites 5 and 6 each bearing a pair of long, erect setae. Ventrum of metasoma with scattered erect setae. Gula with a pair of short setae. Body and appendages, including gula, the entire mesopleuron, and abdominal tergites, covered in dense pubescence.
 Country Admin. Argentina Buenos AiresLocality BocaStatusLatitude Longitude 34° 38' S58° 21'Collection ALWCArgentina Buenos AiresBuenos Aires34° 36' S58° 28' WBMNH, MHNG, NHMB, NHMW, UCDCArgentina Buenos AiresCampana34° 12' S58° 56' WALWCArgentina Buenos AiresReserva Costanera Sur34° 07' S58° 21' WAVSCArgentina Buenos AiresIsla Martin Garcia34° 21' S58° 16' WMACN, NHMBArgentina Buenos AiresLa Plata34° 56' S57° 57' WNHMBArgentina Buenos AiresLima-Zarete34° 03' S59° 12' WIFMLArgentina Buenos AiresOlivos34° 31' S58° 30' WMACNArgentina Buenos AiresReserva Otamendi34° 14' S58° 54' WALWC, AVSC, IFMLArgentina Buenos AiresRosas- F.C.Sud35° 58' S58° 56' WMACNArgentina Buenos AiresSanta Coloma34° 26' S59° 02' WALWCArgentina ChubutRawson43° 18' S65° 06' WPSWCArgentina CorrientesAyo. Cuay Grande28° 47' S56° 17' WALWCArgentina CorrientesCorrientes27° 28' S58° 50' WMACNArgentina CorrientesIta Ibate27° 25' S57° 10' WAVSCArgentina CorrientesPort Alvear29° 07' S56° 33' WAVSCArgentina CorrientesSto. Tome28° 33' S56° 03' WIFMLArgentina Entre Rios10k S Medanos33° 29' S58° 52' WALWCArgentina Entre RiosColon32° 15' S58° 07' WAVSCArgentina Entre RiosDiamante32° 01' S60° 39' WALWCArgentina Entre RiosEst. Sosa31° 44' S59° 55' WMACN, MHNG, NHMBArgentina Entre RiosParque Nacional El Palmar31° 53' S58° 13' WAVSCArgentina Entre RiosParque Nacional Pre Delta32° 7' S60° 38' WAVSCArgentina Entre RiosPort Ibicuy33° 48' S59° 10' WAVSCArgentina Entre RiosVictoria32° 38' S60° 10' WALWCArgentina Entre RiosVillaguay31° 51' S59° 01' WNHMBArgentina FormosaClorinda25° 17' S57° 43' WIFMLArgentina FormosaFormosa26° 11' S58° 11' WMACN, NHMBArgentina FormosaMojon de Fierro26° 03' S58° 03' WIFMLArgentina La RiojaAmingai28° 50' S66° 54' WALWC, IFMLArgentina La RiojaChuquis28° 54' S66° 58' WALWCArgentina MisionesParque Nacional Iguazui25° 42' S54° 26' WIFMLArgentina MisionesPosadas27° 23' S55° 53' WMZSPArgentina Santa Fe10k E Santa Fe, Ruta 16831° 41' S60° 34' WALWCArgentina Santa FeFives Lille30° 09' S60° 21' WNHMBArgentina Santa FePort Ocampo28° 30' S59° 16' WAVSCArgentina Santa FeRosario32° 57' S60° 40' WMACNArgentina Tucumai nTichuco26° 31' S65° 15' WALWCBrazil AmazonasManaus03° 07' S60° 02' WMZSPBrazil GoiasAnapolis16° 20' S48° 58' WMZSPBrazil Mato Grosso do Sul Corumba Faz. Sta. Blanca19° 01' S57° 39' WMZSPBrazil Mato Grosso do Sul Corumba Pto. Esperanga19° 37' S57° 27' WMZSPBrazil Mato Grosso do Sul Passo do Lontra19° 34' S57° 01' WPSWC, UCDCBrazil Mato Grosso do Sul Pto. Murtinho21° 42' S57° 52' WMZSPBrazil Rio de JaneiroRio de Janeiro22° 54' S43° 14' WMCSN, MCZC, MHNGBrazil Rio Grande do SulN. Wurtemberg28° 18' S53° 30' WMZSPBrazil Rio Grande do SulPelotas31° 46' S52° 20' WBMNHChile La AraucaniaTemuco38° 44' S72° 36' WMZSPChile SantiagoSantiago, Metropolitan area33° 27' S70° 40' WAVSCChile Valparaiso10k E Vina del Mar33° 00' S71° 31' WAVSCColombia QuindioArmenia4° 30' S75° 42' WWPMCEcuador PichinchaCarapungo0° 05' S78° 30' WALWCEcuador PichinchaMitad del Mundo0° 00' S78° 27' WALWCEcuador PichinchaQuito0° 11' S78° 30' WQCAZParaguay Alto ParaguayPto. 14 de Mayo20° 23' S58° 08' WMCSNParaguay Asuncioi nAsuncion25° 16' S57° 40' WIFML, MACN, NHMB, USNMParaguay BoqueronP.N. Defensores del Chaco, Cerro Leon20° 25' S60° 20' WALWCParaguay CentralSan Lorenzo25° 20' S57° 31' WALWCParaguay CordilleraSan Bernadino25° 16' S57° 19' WMHNGParaguay N eembucuPilar26° 52' S58° 18' WALWCParaguay Neembucu26° 52' S57° 47' WALWCParaguay Pte. HayesBenjamin Aceval24° 58' S57° 34' WUSNMParaguay Pte. HayesRio Confuso, Ruta Trans-Chaco25° 06' S57° 33' WALWC, IBNPParaguay Pte. HayesVilla Hayes25° 06' S57° 34' WALWC, IBNPParaguay Pte. Hayes5k SE Pozo Colorado23° 33' S58° 46' WALWCParaguay Pte. HayesRt. 5 3k SE Concepcion23° 27' S57° 27' WALWCParaguay San PedroPto. Rosario24° 30' S57° 00' WALWCPeru LimaLos Condores12° 03' S77° 03' WMZSPUruguay ColoniaCarmelo33° 59' S58° 17' WMACN, NHMBUruguay ColoniaColonia de Sacramento34° 28' S57° 51' WAVSCUruguay MontevideoMontevideo34° 51' S56° 10' WMACN, NHMB, NHMW
 Body and appendages concolorous, most commonly a medium reddish or yellowish brown but ranging in some populations from testaceous to dark brown, never yellow or piceous. Integument shagreened and lightly shining.
  Worker Geographic Variation. Specimens from introduced populations outside of South America tend to fall toward the upper range of size variation in nearly all measurements, although there is considerable variation both in the native and the introduced ranges. The holotype worker from Buenos Aires is among the largest ants from either range. Some Paraguayan populations, particularly those farther than 10 km from the Paraguay River, have a slightly smaller eye size (<95 ommatidia) and tend to be smaller than ants in the southern Parana drainage and along the major riverways. In general, Paraguayan specimens vary more in color than specimens from elsewhere, from testaceous to dark brown. The diagnostically sparse pilosity is generally consistent across all specimens, but several workers from Campana, Buenos Aires, have small erect setae on abdominal tergite 4 (= gastric tergite 2). These Campana workers otherwise fall within the range ofvariation for L. humile , and males from the same series clearly belong to L. humile .
 Queen Measurements. (n = 13) HL 0.83-0.92, HW 0.83-0.93, SL 0.81-0.89, WGL 4.42-4.51, WL 1.67- 2.09, FL 0.78-0.90, LHT 0.88-0.97, ES 7.3-9.4, SI 96- 102, CI 93-101.
  Queen Diagnosis. A robust species, dificult to distinguish from queens ofrelated Linepithema , with long antennal scapes and large eyes. Head in full face view normally somewhat longer than broad (CI 93-101), lateral margins convex and broadly curved into the posterior margin. Posterior margin ofhead straight to slightly concave, never deeply or conspicuously concave. Eyes large (ES 7.3-9.4). Antennal scapes long (SI 96 -102) and nearly equal to head length.
 Entire body covered in a dense pubescence, a bit thicker and longer than that of the worker. Pilosity is also more developed than in the worker, with 2-11 (mean = 6) erect setae on the mesoscutum, 1-7 (mean = 4) erect setae on the scutellum, and 1-10 (mean = 3) erect setae on abdominal tergite 3, including the posterior row. Color as for the worker.
 Queen Geographic Variation. Alate queens are much more common in collections from the native range than in collections from outside of South America. This observation is unlikely to be a sampling artifact given how heavily the introduced populations are represented in collections.
 Male Measurements. (n = 25) HL 0.56-0.71, HW 0.56-0.74, SL 0.13-0.16, MML 1.40-1.96, MMW 0.76- 1.12, WGL 2.55-3.26, FL 0.60-0.77, LHT 0.51-0.66, SI 12.8-15.4, CI 98.2-106.0.
 Male Diagnosis. A robust ant, larger than the worker, with an exceptionally well-developed mesosoma. Head about as broad as long in full face view (CI 98.2-106.0) and somewhat dorso-ventrally compressed in lateral view. Eyes large, occupying much of antero-lateral surface of head and forming the anterior margin ofthe head lateral to the clypeus and the lateral margin of the head anterior to midpoint. Ocelli large and in full frontal view set above the adjoining postero-lateral margins. Anterior clypeal margin straight to broadly convex. Mandibles small, having a single apical tooth and four to eight denticles along the masticatory margin and rounding into the inner margin. Masticatory margin relatively short, about the same length as the inner margin. Inner margin roughly parallel to, or even converging distally with, the exterior lateral margin.
 Mesosoma well-developed, considerably wider than head width, and larger in bulk and in length than metasoma. Mesoscutum greatly enlarged, projecting forward in a convexity overhanging the pronotum. Scutellum large, convex, nearly as tall as mesoscutum and projecting well above the level ofthe propodeum. Propodeum overhanging petiolar node, and declivitous face strongly concave.
 Wings short relative to mesosomal length (Fig. 17) and bearing a single submarginal cell. Wing color whitish or yellowish, with dark brown veins and stigma. Petiolar scale with a broad crest and taller than the length of the node. Ventral process well developed. Gaster oval in dorsal view, nearly twice as long as broad. Parameres terminating as rounded pilose lobes. Digitus short, with a sharp, downturned terminal ilament.
 Dorsal surfaces of body largely devoid of erect setae, occasionally with a few ine, short setae scattered on mesoscutum, scutellum, and posterior abdominal tergites. Venter of gaster with scattered setae. Pubescence dense on body and appendages, becoming sparse only on the medial propodeal dorsum. Color as for the worker.
 Male Geographic Variation. As in workers, specimens from introduced populations outside of South America tend to fall in the upper range of size variation.
 Discussion
  Taxonomy. These taxonomic results support current nomenclatural use. The holotype worker of Mayr's Hypoclinea humilis falls neatly within the range of variation present in the Argentine ant both in South America and in locations around the world where the ant is invasive (Figs. 15 and 16). The only older species-level name in the genus, Linepithema fuscum Mayr 1866, pertains to a male ant whose slender build, elongate genitalia, and distinct queen-like wing venation indicate only a distant relation to L. humile . Borgmeier's species riograndense , described from Rio Grande do Sul, Brazil, is clearly conspecific with L. humile and is synonymized here. Borgmeier's specimen identifications in MZSP reveal that he considered the name humile to apply to a common, probably undescribed southern Brazilian Linepithema with short antennal scapes and more extensive pilosity. The aptly named subspecies L. humile arrogans Chopard , described from introduced L. humile populations in southern France, was probably inadvertently resurrected by Shattuck (1992) from an earlier synonymy. Here, I return arrogans to synonymy because there is no reason to view introduced Argentine ant populations as being heterospeciic.
 Diagnosis . L. humile diagnosis is straightforward in the male caste. The distinctive bulky males of humile are not easily confused with males of any other species. Males of closely related forms share structural similarities with L. humile (e.g., the undescribed species in Fig. 14) but are considerably smaller (Fig. 17) with a much less developed mesosoma. The lack of known intergrades strongly supports the speciic status of L. humile . The only other congeneric males that share the size of humile are montane Andean and Caribbean forms associated with L. fuscum , but these are unlikely to be confused with L. humile . Linepithema fuscum -group males are structurally divergent (Shattuck 1992), with an unusually elongate habitus, a propodeum with a convex posterior face in lateral view, two submarginal cells in the forewing, and considerably longer wings relative to maximum mesosomal length (Fig. 17).
  Diagnosis is somewhat more problematic in workers, as no single character serves to separate L. humile from congeneric species. Table 2 provides a summary of the minimum combination of three character states that can diagnose nearly all L. humile worker specimens over the full geographic distribution of Linepithema . Figure 15 shows a consistent though not absolutely diagnostic difference in eye size versus head length between the large-eyed L. humile and all other non-humile specimens. Figure 16 plots antennal scape length versus head length in L. humile versus several other species, excluding the distinct long-scaped species L. oblongum , L. leucomelas , and ants of the L. iniquum -complex. These species are readily recognizable with other characters. Specifically, iniquum-complex ants have a strongly impressed mesonotal dorsum (Fig. 3), pronotal setae, and smaller eyes (ES <2.0). L. leucomelas has a distinct white/brown bicoloration reminiscent of the ant Tapinoma melanocephalum (F.) 1793, standing setae on gastric tergites 1 and 2, and smaller eyes (ES <2.0).
 L. oblongum (Fig. 6) is the species most similar to L. humile . This poorly known ant seems to be conined to the high Andes in northern Argentina and Bolivia. Workers share the sparse pilosity and a similar mesosomal proile with L. humile , but they are somewhat more elongate (CI 81-88, mean = 84 in L. oblongum ; CI 84 -93, mean = 90 in L. humile ) and have relatively smaller eyes (Fig. 18). Linepithema oblongum workers also have a noticeably smoother and shinier integument on the gastric dorsum than L. humile , and most workers have only sparse pubescence on gastric tergites2 and 3, although some of the larger specimens within a series may retain a dense pubescence. Males of L. oblongum are much smaller than those of L. humile (MML <1.1), and they lack the extraordinary mesosomal development of L. humile males. This species may be the sister taxon of the Argentine ant, a possibility that is currently being pursued with molecular genetic data (unpublished data).
  . The Argentine ant's native distribution seems to be limited to the Parana River drainage (Fig. 19), conirming the conclusion of Tsutsui et al. (2001). South American records of L. humile outside the Paranaa drainage are invariably from urban areas, an observation that strongly supports the notion of recent introduction by human commerce. Paranaa drainage records are also more abundant than nonParanaa records (49 versus 8). Furthermore, most records fall within a few kilometers of the largest rivers: the Parana, the Paraguay, and the Uruguay. This is unlikely to be a sampling artifact, as evidenced from numerous records of other, non-humile species distant from major rivers (Fig. 20).
  Records of L. humile in South America show the following pattern: patchy local abundance in low areas of the Parana River drainage; common along major rivers (perhaps aided through frequent natural dispersal along the river); and very recent dispersal out of the Parana drainage with human activity. Interestingly, some of the more morphologically divergent L. humile , including those with color variations and smaller compound eyes, are found>10 kilometers away from large rivers in the northern part of the native range. It is unlikely that this variation reflects the existence ofcryptic species, given that much ofthe variation is allopatric and that L. humile males show remarkable consistency in diagnostic traits across populations. Specimens from the southern native range tend to look more like the common pest L. humile , although there is still a fair amount of variation. Overall this pattern raises the hypothesis of a northern origin for the species with later dispersal along the rivers. This hypothesis could be tested with genetic data in a phylogeographic framework (Avise 2000).
  The history and biology of the Argentine ant in its native range is liable to be complex. Argentine ants likely move along river channels during periods of natural disturbance, and some of the native range records probably correspond to recent local introductions through human commerce. It bears noting that L. humile is present in many urban areas along the Paranaa and Paraguay rivers. The preponderance of Argentine ant records from lat, expansive lood plains suggests that records from fast-running, deeply channelized stretches of the Upper Parana such as Argentina's Foz do Iguacu also may not represent native populations.
  The morphological diversity in native-range L. humile raises the issue of intraspeciic diversity in other aspects of Argentine ant biology. Tsutsui and Case (2001) note variation in colony structure in the native range, and there also may be variation in mating systems and in colony life history. Studies that make use of contrasts between Argentine ant biology between native and introduced ranges would do well not to treat native range L. humile as a monolithic entity.
  Rather, care should be taken to chose L. humile populations that are most likely to be close relatives of the introduced populations under study. Genetic work of Tsutsui et al. (2001) indicates that a southern Parana population represents the source population for California L. humile . It also remains a possibility that some biological changes that contribute to the Argentine ants' invasive success occurred within the native range before introduction. Detailed studies ofArgentine ant biology mapped onto a population-level phylogeny over the whole of the native range could determine if this were the case, as well as shed light on the sequence of evolutionary events leading to invasiveness in Argentine ants.
 

Espadaler, X., 2007:
 (2, w; 8, w, m; 1 5, w; 2 3, w; 26, w; 31, w; 41, w; 44, w; 45, w). The Argentine ant is known from all the Canary Islands (Espadaler & Bernal, 2003). At El Hierro it occupies habitats from next to sea level to one thousand meters, in pine forests. Confronted with the two populations known to exist in North Mediterranean Europe (Giraud et al., 2002), the Argentine ants from El Hierro showed aggressiveness towards the Catalan population and reacted peacefully towards the Main population from mainland Europe. Aggression tests (one to one worker; five replicates) were run with two samples from El Hierro (La Frontera; Mirador de las Playas). I conclude that both samples from El Hierro belong to the genotypic profile of the Main population, the more abundant in Western Mediterranean Europe.
 

Ward, P. S., 2005:
 I [introduced species]
 

Wild, A. L., 2007:
 Hypoclinea humilis Mayr 1868: 164 (W). Holotype worker, Buenos Aires, Argentina, Stroebel, 1866 [NHMW, examined].
 Iridomyrmex humilis (Mayr) . Emery 1888: 386-388. First combination in Iridomyrmex .
 Iridomyrmex humilis (Mayr) . Wheeler 1913a: 27-29 (M, Q, W). Male and queen description, worker redescription.
 Iridomyrmex humilis (Mayr) . Newell and Barber 1913: 38-39 (egg), 40-41 (larva), 42-45 (W, M, Q pupae).
 Iridomyrmex humilis var. arrogans Chopard 1921: 241-245 (W). Lectotype worker, by present designation [NHMB, examined], Cannes, Provence-Alpes-Cote d'Azur, France, Chopard [NHMB, examined]. Junior synonym of I. humilis by Bernard 1967: 251. Restored to subspecies of L. humile (Mayr) by Shattuck 1992a: 16. Returned to synonymy by Wild 2004: 1207.
 Iridomyrmex riograndensis Borgmeier 1928: 64 (W). Lectotype worker, by present designation [MZSP, examined] and 7 worker paralectotypes, Rio Grande do Sul (s.loc.), Brazil, 19.i.1918 [MZSP, examined]. Junior synonym of L. humile (Mayr) by Wild 2004: 1207.
 Iridomyrmex humilis (Mayr) . Wheeler and Wheeler 1951: 186-189. Summary of larval biology.
 Iridomyrmex humilis (Mayr) . Crozier 1969: 250. Karyotype.
 Linepithema humile (Mayr) . Shattuck 1992a: 16. First combination in Linepithema .
 Linepithema humile arrogans (Chopard) . Shattuck 1992a: 16. First combination in Linepithema .
 Linepithema riograndensis (Borgmeier) . Shattuck 1992a: 16. First combination in Linepithema .
 Linepithema humile (Mayr) . Shattuck 1994: 123.
 Linepithema humile arrogans (Chopard) . Shattuck 1994: 123.
 Linepithema riograndensis (Borgmeier) . Shattuck 1994: 127.
 Linepithema humile (Mayr) . Bolton 1995: 247.
 Linepithema humile arrogans (Chopard) . Bolton 1995: 246.
 Linepithema riograndensis (Borgmeier) . Bolton 1995: 247.
 Linepithema humile (Mayr) . Wild 2004: 1204-1215 (M, Q, W). Distribution and taxonomic redescription.
  worker measurements: HL 0.74, HW 0.66, MFC 0.16, SL 0.76, FL 0.65, LHT 0.68, PW 0.45, ES 2.93, SI 115, CI 89, CDI 24, OI 40.
 Worker measurements: (n = 81) HL 0.62-0.78, HW 0.53-0.72, MFC 0.14-0.18, SL 0.62-0.80, FL 0.52-0.68, LHT 0.57-0.76, PW 0.35-0.47, ES 1.98-3.82, SI 108-126, CI 84-93, CDI 23-28, OI 32-49.
 Worker diagnosis: Eyes large (OI> 30); antennal scapes long (SI> 105); pronotum and first two gastric tergites lacking erect setae; mesopleura and metapleura densely pubescent.
 Worker description: Head in full face view longer than broad (CI 84-93), narrowed anteriorly and reaching its widest point just posterior to compound eyes. Lateral margins broadly convex, grading smoothly into posterior margin. Posterior margin straight in smaller workers to weakly concave in larger workers. Compound eyes large (OI 32-49), comprising 82-110 ommatidia (normally around 100). Antennal scapes long (SI 108-126), as long or slightly longer than HL and easily surpassing posterior margin of the head in full face view. Frontal carinae narrowly to moderately spaced (CDI 23-28). Maxillary palps relatively short, shorter than Vi HL, ultimate segment (segment six) noticeably shorter than segment 2.
 Pronotum and mesonotum forming a continuous convexity in lateral view, mesonotal dorsum nearly straight, not angular or strongly impressed, although sometimes with a slight impression in anterior portion. Metanotal groove moderately impressed. Propodeum in lateral view inclined anteriad. In lateral view, dorsal propodeal face meeting declivity in a distinct though obtuse angle, from which the declivity descends in a straight line to the level of the propodeal spiracle.
 Petiolar scale sharp and inclined anteriorly, in lateral view falling short of the propodeal spiracle.
 Dorsum of head (excluding clypeus), mesosoma, petiole, and gastric tergites 1-2 (= abdominal tergites 3-4) devoid of erect setae (very rarely with a pair of small setae on gastric tergite 2). Gastric tergites 3-4 each bearing a pair of long, erect setae. Venter of metasoma with scattered erect setae.
 Integument shagreened and lightly shining. Body and appendages including gula, entire mesopleura, metapleura, and abdominal tergites covered in dense pubescence.
 Body and appendages concolorous, most commonly a medium reddish or yellowish brown but ranging in some populations from testaceous to dark brown, never yellow or piceous.
  measurements: (n = 13) HL 0.83-0.92, HW 0.83-0.93, SL 0.81-0.89, FL 0.78-0.90, LHT 0.88-0.97, EL 0.31-0.36, MML 1.67-2.09, WL 4.42-4.51, CI 93- 101, SI 96-102, OI 36-39, WI 24-27, FI 40-48.
 Queen description: Moderately large species (MML 1.67-2.09). Head slightly longer than broad to as broad as long in full face view (CI 93-101), posterior margin slightly concave to slightly convex. Eyes of moderate size (OI 36-39). Ocelli small. Antennal scapes relatively long (SI 96-102), in full face view scapes in repose surpassing posterior margin by a length greater than length of first funicular segment.
 Forewings short relative to mesosomal length (WI 24-27). Forewings with Rs+M at least three times longer than M.f2. Legs of moderate length relative to mesosomal length (FI 40-48).
 Dorsum of mesosoma and metasoma with scattered standing setae. Mesoscutum bearing 2-11 standing setae. Body color medium reddish brown. Antennal scapes, legs, and mandibles concolorous with body.
 Male measurements: (n = 12) HL 0.56-0.70, HW 0.56-0.74, SL 0.13-0.16, FL 0.60- 0.77, LHT 0.51-0.66, EL 0.31-0.34, MML 1.40-1.96, WL 2.55-3.26, PH 0.25-0.34, CI 99-106, SI 22-27, OI 51-55, WI 17-20, FI 37-45.
 Male diagnosis: Forewing with single submarginal cell; mesosoma robust (MML> 1.3), mesoscutum greatly enlarged and overhanging pronotum; wings short relative to mesosomal length (WI <21).
 Male description: Head about as broad as long in full face view (CI 99-106). Eyes large (OI 51-55), occupying much of anterolateral surface of head and separated from posterolateral clypeal margin by a length less than width of antennal scape. Ocelli large and in full frontal view set above adjoining posterolateral margins. Antennal scape of moderate length (SI 22-27), about 2/3 length of 3rd antennal segment. Anterior clypeal margin straight to broadly convex. Mandibles small, bearing a single apical tooth and 4-8 denticles along masticatory margin and rounding into inner margin. Masticatory margin relatively short, subequal in length to inner margin. Inner margin roughly parallel to, or converging distally with, exterior lateral margin.
 Mesosoma unusually well developed, considerably wider than head width, and larger in bulk and in length than metasoma. Mesoscutum greatly enlarged, projecting forward in a convexity overhanging pronotum. Scutellum large, convex, nearly as tall as mesoscutum and projecting well above level of propodeum. Propodeum well developed and overhanging petiolar node, posterior propodeal face strongly concave. Forewings short relative to mesosomal length (WI 17-20) and bearing a single submarginal cell. Wing color whitish or yellowish with dark brown veins and stigma. Legs short relative to mesosoma length (FI 37-45).
 Petiolar scale taller than node length and bearing a broad crest. Ventral process well developed. Gaster oval in dorsal view, nearly twice as long as broad. Gonostylus produced as a bluntly rounded pilose lobe. Volsella with cuspis present, digitus short and downturned distally.
 Dorsal surfaces of body largely devoid of erect setae, occasionally with a few fine, short setae scattered on mesoscutum, scutellum, and posterior abdominal tergites. Venter of gaster with scattered setae. Pubescence dense on body and appendages, becoming sparse only on medial propodeal dorsum.
 Color as for worker.
 Distribution: Native to the Parana river drainage of Brazil, Paraguay, Argentina, and Uruguay. Introduced worldwide.
 Biology: This important pest species has a literature too extensive to be covered in depth here. An early general review of the biology of this ant is given by Newell and Barber (1913). The spread of Argentine ants around the world is documented by Roura-Pascual et al. (2004), Wild (2004), Giraud et al. (2002), and Suarez et al.
  (2001). Ecological impacts of Argentine ant invasion have been detailed in numerous studies, including Suarez and Case (2003), Touyama et al. (2003), Christian (2001), and Human and Gordon (1997). Colony structure has also received considerable attention, and relevant papers include Holway and Suarez (2004), Tsutsui and Case (2001), Reuter et al. (2001), and Kreiger and Keller (2000). A series of studies by Cavill and colleagues (Cavill and Houghton 1973, Cavill and Houghton 1974, Cavill et al. 1980) describe some of the glandular and cuticular chemistry of L. humile . Chemical and biological control options are reviewed by Harris (2002).
  Of the L. humile material examined, more than 90% of native range records are within 10 kilometers of a major river in the Parana drainage. Contrary to some reports (Buczkowski et al. 2004), L. humile can reach high densities in urban areas in Argentina and Paraguay (Wild 2004) as well as in less disturbed habitats (Heller 2004). Where nest information was recorded in the native range, 24 nests are from soil, five from under covering objects such as stones or garbage, one from an old termite mound, and one from under bark. This species is polygynous and polydomous, and many nests are recorded as having numerous dealate queens. In contrast to introduced populations, alate queens are not uncommon in nests in Argentina (Wild 2004). One observation in Victoria, Argentina, notes a live lycaenid larva in the brood nest (Wild, pers. obs.).
  species: Workers of the sister species L. oblongum , from the high Andes of Bolivia and northern Argentina, normally have at least some members of each series with dilute pubescence on gastric tergites 2-4. These ants also have, on average, smaller eyes (OI 28-38, Fig. 86) and longer antennal scapes (SI 120-139, Fig. 85) than L. humile . Workers of L. anathema, a rarely-collected Brazilian species, have a more produced propodeum (Fig. 33), a narrow head (CI <86), and usually bear short standing setae on gastric tergites 1-2. Workers of other Humile-group species have shorter antennal scapes and often bear erect setae on the pronotum and basal gastric tergites. Males of related species are much smaller than L. humile and lack the greatly swollen mesosoma.
  Discussion: The taxonomy and distribution of L. humile was recently reviewed in depth by Wild (2004).
  Material examined: ARGENTINA. Buenos Aires: Boca, 34°38'S 58°21'W [ALWC];Buenos Aires, 34°36'S 58°28'W [BMNH, MHNG, NHMB, NHMW, UCDC];Campana, 34°12'S 58°56'W [ALWC, BMNH, CASC, MZSP];Reserva Costanera Sur, 34°07'S 58°21'W [AVSC];Isla Martin Garcia [MACN, NHMB];La Plata [NHMB];Lima-Zarete [IFML];Olivos [MACN];Reserva Otamendi, 34°14'S 58°54'W [ALWC, AVSC, IFML];Rosas- F.C.Sud [MACN];Santa Coloma, 34°26'S 59°02'W [UCDC].Chubut: Rawson, 43°18'S 65°06'W [PSWC].Corrientes: Ayo. Cuay Grande, 28°47'S 56°17'W [UCDC];Corrientes [MACN];Ita Ibate, 27°25'S 57°10'W [AVSC];Port Alvear, 29°07'S 56°33'W [AVSC];Sto. Tome, 28°33'S 56°03'W [IFML].Entre Rios: 10 km S Medanos, 33°29'S 58°52'W [ALWC, BMNH];Colon, 32°15'S 58°07'W [AVSC];Diamante, 32°01'S 60°39'W [ALWC];Est. Sosa [MACN, MHNG, NHMB];Parque Nacional El Palmar, 31°53'S 58°13'W [AVSC];Parque Nacional Pre Delta, 32°7'S 60°38'W [AVSC];Port Ibicuy, 33°48'S 59°10' [AVSC];Victoria, 32°38'S 60°10'W [ALWC];Villaguay [NHMB]. Formosa: Clorinda [IFML];Formosa [MACN, NHMB];Mojon de Fierro [IFML].La Rioja: Aminga, 28°50'S 66°54'W [ALWC, IFML, UCDC];Chuquis, 28°54'S 66°58'W [UCDC].Misiones: Parque Nacional Iguazu, 25°42'S 54°26'W [IFML];Posadas [MZSP].Santa Fe: 10 km E Santa Fe, Ruta 168, 31°41'S 60°34'W [ALWC, MCZC, USNM];Fives Lille [NHMB];Port Ocampo, 28°30'S 59°16'W [AVSC];Rosario [MACN].Tucuman: Tichuco, 26°31'S 65°15'W [UCDC].AUSTRALIA. New South Wales: Sydney [MZSP].Victoria (s. loc.) [BMNH].BELGIUM. Bruxelles Capitale: Brussels [BMNH, NHMB],Brussels Botanical Garden [MHNG].BERMUDA. Bermuda (s. loc.) [BMNH].BRAZIL. Amazonas: Manaus [MZSP].Goias: Anapolis [MZSP].Mato Grosso do Sul: Corumba, Faz. Sta. Blanca [MZSP];Corumba, Pto. Esperanca [MZSP];Passo do Lontra, 19°34'S 57°01'W [PSWC, UCDC];Pto. Murtinho [MZSP].Rio de Janeiro: Rio de Janeiro [MCSN, MCZC, MHNG].Rio Grande do Sul: N. Wurtemberg [MZSP];Pelotas [BMNH].Brazil (s.loc.), Port-of-entry U.S. intercept [ALWC, UCDC, USNM]. CAMEROON. Centre-Sud: Nkoemvom [BMNH]. CHILE . Bio-Bio: 3 km W Florida [UCDC]; Los Angeles, 37°26'S 72°19'W [UCDC].Coquimbo: Los Vilos [UCDC].La Araucania: Temuco [MZSP].Maule: 10 km E Curico [UCDC].Region Metropolitana: Talagante [UCDC].Santiago: Santiago, Metropolitan area, 33°27'S 70°40'W [AVSC].Valparaiso: 10 km E Vina del Mar, 33°00'S 71°31'W [AVSC];nr. El Melon, 1 km N of tunnel [UCDC].COLOMBIA. Quindio: Armenia [WPMC].ECUADOR. Pichincha: Carapungo, 00°05'S 78°30'W [ALWC, QCAZ];Mitad del Mundo, 00°00'S 78°27'W [ALWC, BMNH, MCZC];Quito, 00°11'S 78°30'W [QCAZ].FRANCE. Provence-Alpes-Cote d'Azur: Cannes [MCZC, NHMB],Castellane [BMNH],Hyeres [BMNH],Ste. Maxime [NHMB].Midi-Pyrenees: Toulouse [IFML].GERMANY. Berlin: Botanical Garden [MHNG].ITALY. Campania: nr. Naples [BMNH].Liguria: San Remo [NHMB].Sicilia: Palermo [BMNH].Toscana: Monte Argentario Giannella [BMNH];Orbetello [BMNH];Varazze (Savona) [MZSP].LESOTHO. Maseru: Maseru [BMNH].MOROCCO. Tanger: Tangier [USNM].MEXICO. Baja California: Ensenada, Cortera FR [AVSC].Baja California Sur: Guerrero Negro [AVSC].Distrito Federal: Mexico City [BMNH];Distrito Federal (s.loc.) [WPMC].Guanajuato: Guanajuato [ALWC].Mexico: 18 km SW Toluca [UCDC].NAMIBIA. Erongo: Swakopmund [BMNH].PARAGUAY. Alto Paraguay: Pto. 14 de Mayo [MCSN].Asuncion: Asuncion [IFML, MACN, NHMB, USNM].Boqueron: P.N. Defensores del Chaco, Cerro Leon [ALWC].Central: San Lorenzo, 25°20'S 57°31'W [ALWC].Cordillera: San Bernadino [MHNG].Neembucu: Pilar, 26°52'S 58°18'W [ALWC, MCZC];26°52'S 57°47'W [ALWC, LACM].Pte. Hayes: Benjamin Aceval [USNM];Rio Confuso, Ruta Trans-Chaco [ALWC, INBP];Villa Hayes, 25°06'S 57°34 W [ALWC, INBP, MCZC];5 km SE Pozo Colorado, 23°33'S 58°46' [ALWC, BMNH, INBP, MCZC, USNM];Rt. 5, 3 km SE Concepcion, 23°27'S 57°27'W [ALWC].San Pedro: Pto. Rosario, 24°30'S 57°00'W [ALWC, MZSP].PERU. Lima: Los Condores [MZSP].POLAND. Dolnoslaskie: Breslau [NMHB].PORTUGAL. Faro: Algarve, Luz nr. Lagos [BMNH].Lisboa: Cascais [USNM];Estoril [USNM];Lisbona [MCZC, NHMB];Mafra [USNM];Praia das Macas [USNM].Madeira: Funchal [MCZC, NHMB];Porto Moniz [BMNH];Ribeira Brava [BMNH];Ilheu Chao [BMNH];Porto Santo [BMNH];Sao Vicente [BMNH];Vale de Paraiso [BMNH];Praia Formosa [BMNH];Porto da Cruz [BMNH];Feiteiras [BMNH];Caramujo [BMNH];Lower Levada [BMNH],Madeira Is. (s. loc.) [BMNH, MHNG, NHMB].Porto: Leca [BMNH];Oporto [BMNH].SOUTH AFRICA. Eastern Cape: Queenstown [BMNH];Somerset East [BMNH].Mpumalanga: Nelspruit [BMNH].Northern Cape: Colesberg [ALWC, MCZC].Western Cape: Capetown [BMNH];Table Mt. [BMNH];nr. George [BMNH].SPAIN. Andalucia: Malaga [USNM].Canarias: Arenara [BMNH];Cruz de Tejeda [BMNH];Gran Canaria, Las Palmas, Telde [BMNH, MCZC, USNM];Orotava [BMNH];Santa Brigida [BMNH];Tenerife, Agua Mansa [NHMB];Tenerife, Ladera de Guimar [BMNH];Tenerife, Volcan de Guimar [NHMB];Tenerife (s. loc.) [BMNH].Cataluna: Playa de Aro [NHMB].Galicia: Mte. Ferro b. Bayona [BMNH].Islas Baleares: Minorca, Cala Forcat [BMNH].THAILAND. Port-of-entry U.S. intercept [USNM].UNITED KINGDOM. Edinburgh: Edinburgh [BMNH]. Sussex: Lewes [BMNH].Eastborne [BMNH].Exeter [BMNH].Windsor [BMNH].Glasgow [BMNH].W. Maidstone, Kent [BMNH].Chillingham [BMNH].Farnham House Lab, Imperial Bureau of Entomology [BMNH].U.S.A. Alabama: Lowdnes Co., Ft. Deposit [USNM].California: Alameda Co.,Berkeley [UCDC, USNM];Humboldt Co., Redway [ALWC, BMNH];Los Angeles Co., Pasadena [MZSP, USNM];Los Angeles Co.: Sta. Monica Mts, Big Rock Road, 34°02'N 118°37'W [UCDC];Monterrey Co., Big Sur [ALWC];Orange Co., Bolsa Chica Marsh [MZSP];Riverside Co., Lake Skinner Camp [AVSC];Sacramento Co., Sacramento [UCDC];San Diego Co., UC Elliot Reserve [AVSC];San Diego Co., San Diego [UCDC];San Diego Co., E. San Diego [UCDC];San Diego Co., Pacific Beach [UCDC];San Diego Co., Mission Hills [UCDC];San Diego Co., Kate Sessions Park [UCDC];San Diego Co., Balboa Park [UCDC];San Diego Co., Point Loma [UCDC];San Joachin Co., Caswell State Park [PSWC];San Luis Obispo Co., Oso Flaco Lake [LACM];San Mateo Co., Colma [USNM];San Mateo Co., San Bruno Mt. [PSWC];Santa Clara Co., South Coyote [PSWC];Sonoma Co., Russian R. 6 km E. Healdsburg [UCDC];Yolo Co., 6 km W Capay [PSWC];Yolo Co., Davis [PSWC, UCDC];Yolo Co., Grasslands Regional Park, 8 km SW Davis [PSWC, UCDC].Florida: Escambia Co., Gonzalez [MCZC].Louisiana: Plaquemines Parish., Happy Jack [BMNH];Orleans Parish, New Orleans [BMNH];Louisiana (s. loc.) [BMNH].Mississippi: Coahoma Co., Clarkesdale [USNM];Copiah Co., Hazelhurst [MCZC];Oktibbeha Co., Starkville [BMNH].South Carolina: York Co., York [BMNH].URUGUAY. Colonia: Carmelo [MACN, NHMB];Colonia de Sacramento, 34°28'S 57°51'W [AVSC].Montevideo: Montevideo [MACN, NHMB, NHMW].
 

Wild, A. L., 2007:
  Alto Paraguay, Boquerón , Central, Ñeembucú , Pte. Hayes, San Pedro, “ Paraná R.” (Dept. unknown) (ALWC, BMNH, IFML, INBP, MACN, MCSN, MCZC, MHNG, MZSP, NHMB). Literature records: Alto Paraguay, Boquerón , Central, Ñeembucú , Pte. Hayes, San Pedro (Wild 2004, Wild 2007).
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Identification

  Diagnosis among workers of introduced and commonly intercepted ants in the United States. Antenna 12-segmented. Antennal scape length less than 1.5x head length. Eyes medium to large (greater than 5 facets); do not break outline of head; placed distinctly below midline of face. Antennal sockets and posterior clypeal margin separated by a distance less than the minimum width of antennal scape. Anterior clypeal margin variously produced, but never with one median and two lateral rounded projections. Mandible lacking distinct basal angle. Profile of mesosomal dorsum with two distinct convexities. Dorsum of mesosoma lacking a deep and broad concavity; lacking erect hairs. Promesonotum separated from propodeum by metanotal groove. Propodeum with dorsal surface not distinctly shorter than posterior face; angular, with flat to weakly convex dorsal and posterior faces. Propodeum and petiolar node both lacking a pair of short teeth. Mesopleura and metapleural bulla covered with dense pubescence. Propodeal spiracle bordering posterior margin of propodeal profile. Waist 1-segmented. Petiole upright and not appearing flattened. Gaster armed with ventral slit. Erect hairs lacking from cephalic dorsum (above eye level), pronotum, and gastral tergites 1 and 2. Dull, not shining, and color uniformly light to dark brown. Measurements: head length (HL) 0.56–0.93 mm, head width (HW) 0.53–0.71 mm.

 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnosis of worker among Antkey species. Antenna 12-segmented. Antennal scape length less than 1.5x head length. Eyes medium to large (greater than 6 facets); do not break outline of head; placed distinctly below midline of face. Antennal sockets and posterior clypeal margin separated by a distance less than the minimum width of antennal scape. Anterior clypeal margin variously produced, but never with one median and two lateral rounded projections. Mandible lacking distinct basal angle. Profile of mesosomal dorsum with two distinct convexities. Dorsum of mesosoma lacking a deep and broad concavity; lacking erect hairs. Promesonotum separated from propodeum by metanotal groove. Propodeum with dorsal surface not distinctly shorter than posterior face; angular, with flat to weakly convex dorsal and posterior faces. Propodeum and petiolar node both lacking a pair of short teeth. Mesopleura and metapleural bulla covered with dense pubescence. Propodeal spiracle bordering posterior margin of propodeal profile. Waist 1-segmented. Petiole upright and not appearing flattened. Gaster armed with ventral slit. Erect hairs lacking from cephalic dorsum (above eye level), pronotum, and gastral tergites 1 and 2. Dull, not shining, and color uniformly light to dark brown. Measurements: head length (HL) 0.56–0.93 mm, head width (HW) 0.53–0.71 mm.


Among the species treated here, Linepithema humile is most easily confused with the Argentine Ant, L. iniquum. It can be separated from that species by the following characters: (1) the mesopleura and metapleural bulla are covered in pubescence and have a dull (versus glabrous) surface; (2) erect hairs are lacking (versus present) on cephalic dorsum (above eye level), gastral tergites 1 and 2, and often present on pronotum; (3) the profile of mesosomal dorsum has two (versus three) distinct convexities; (4) the propodeum is angular (versus globular) and is flat or weakly convex with dorsal and posterior faces (versus strongly and uniformly convex); and (5) the propodeal spiracle is bordering (versus distinctly anterior to) the posterior margin of propodeal profile.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Antkey

Source: Antkey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Records

 

(Map 46): Sofia Basin: Sofia; Northern Black Sea coast: Varna; Southern Black Sea coast: Burgas [ Atanassov and Dlusskij 1992 (all as Iridomyrmex humilis )].

License not applicable

Lapeva-Gjonova, Albena

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

(Worker, Figs. 1 and 5; queen, Figs. 8, 9, and 10; male, Figs. 11, 12, and 13)

 

Hypoclinea humilis Mayr 1868: 164. Worker description.

 

Iridomyrmex humilis (Mayr); Emery 1888: 386-388. First combination in Iridomyrmex .

 

Iridomyrmex humilis (Mayr); Wheeler 1913: 27-29. Male and queen description, worker redescription.

 

Iridomyrmex humilis (Mayr); Newell and Barber 1913: 38-39 (egg), 40-41 (larva), 42-45 (worker, male, queen pupae).

 

Iridomyrmex humilis variety arrogans Chopard 1921: 241-245. Syn. Nov. Junior synonym of I. humilis by Bernard 1967: 251. Restored to subspecies of L. humile by Shattuck 1992: 16.

 

Iridomyrmex riograndensis Borgmeier 1928: 64. Syn. Nov.

 

Iridomyrmex humilis (Mayr); Wheeler and Wheeler 1951: 186-189. Summary of larval biology.

 

Linepithema riograndense (Borgmeier) ; Shattuck 1992: 16.

 

Linepithema humile (Mayr); Shattuck 1992: 16. First combination in Linepithema .

 

Type Material Examined

 

Additional Material Examined

 

South American material examined given in Table 1. Specimens collected outside of South America are listed below. Given the large quantity of Argentine ants collected in California, I only list here a representative subsample of California specimens that were given a relatively thorough examination under the microscope (e.g., setal counts and measurements).

 

AUSTRALIA. Sydney [MZSP];Victoria (s. loc.) [BMNH].BELGIUM. Bruxelles Capitale: Brussels [BMNH, NHMB],Brussels Botanical Garden [MHNG].BERMUDA. Bermuda (s. loc.) [BMNH].CAMEROON. Centre-Sud: Nkoemvom [bMNh].FRANCE. Provence-Alpes-Co te d'Azur: Cannes [MCZC, NHMB],Castellane [BMNH],Hyeres [BMNH],Ste. Maxime [NHMB];Midi-Pyrenees: Toulouse [IFML].GERMANY. Berlin: Botanical Garden[MHNG].ITALY. Campania: nr. Naples [BMNH];Liguria: San Remo [NHMB];Sicilia: Palermo[BMNH];Toscana: Monte Argentario Giannella [BMNH],Orbetello [BMNH];Varazze (Savona) [MZSP].LESOTHO. Maseru: Maseru [BMNH]. MO- ROCCO. Tanger, Tangier [USNM].MEXICO. Baja California: Ensenada,Cortera FR [AVSC];Baja California Sur: Guerrero Negro [AVSC];Distrito Federal: Mexico City [BMNH],Distrito Federal (s.loc.) [WPMC].NAMIBIA. Erongo: Swakopmund [BMNH].POLAND. Dolnoslaskie: Breslau [NMHB].PORTUGAL. Faro: Algarve,Luz nr. Lagos [bMNh];Lisboa: Cascais [USNM],Estoril [USNM],Lisbona [MCZC, NHMB],Mafra [USNM],Praia das Macas [USNM];Madeira: Funchal [MCZC, NHMB],Porto Moniz [BMNH],RibeiraBrava [BMNH],Ilheu Chao [BMNH],Porto Santo [BMNH],Sao Vicente [BMNH],Vale de Paraiso [BMNH],Praia Formosa [BMNH],Porto da Cruz [BMNH],Feiteiras [BMNH],Caramujo [BMNH],Lower Levada [BMNH],Madeira Is. (s. loc.) [BMNH, MHNG, NHMB];Porto: Leca [BMNH],Oporto [BMNH].SOUTH AFRICA.Eastern Cape: Queenstown [BMNH],Somerset East [BMNH];Mpumalanga: Nelspruit[BMNH];Northern Cape: Colesberg [ALWC];Western Cape: Capetown [BMNH],Table Mt. [BMNH],nr. George [BMNH].SPAIN. Andalucia: Malaga [USNM];Canarias: Arenara [BMNH],Cruz de Tejeda [BMNH],Gran Canaria, Las Palmas, Telde [BMNH, MCZC, USNM],Orotava [BMNH],Santa Brigida [BMNH],Tenerife, Agua Mansa [NHMB],Tenerife, Ladera de Guimar [BMNH],Tenerife, Volcan de Guimar [NHMB],Tenerife (s. loc.) [BMNH];Cataluna: Playa de Aro [NHMB];Galicia: Mte. Ferro b. Bayona [BMNH];IslasBaleares: Minorca, CalaForcat[BMNH].UNITED KINGDOM. Edinburgh: Edinburgh[BMNH];Sussex: Lewes [BMNH];Eastborne[BMNH];Exeter [BMNH];Windsor [BMNH];Glasgow [BMNH];W. Maidstone, Kent [bMNh];Chillingham [BMNH];Farnham House Lab, Imperial Bureau of Entomology [BMNH].UNITED STATES. Alabama: Lowdnes Co., Ft. Deposit [USNM];California: Alameda Co., Berkeley [UCDC, USNM];Humboldt Co., Redway [ALWC];Los Angeles Co., Pasadena[MZSP, USNM], Monterrey Co., Big Sur [ALWC];Orange Co., Bolsa Chica Marsh [MZSP];Riverside Co., Lake Skinner Camp [AVSC];Sacramento Co., Sacramento [UCDC];San Diego Co., UC Elliot Reserve [AVSC];San Diego Co., San Diego [UCDC];San Diego Co., E. San Diego [UCDC];San Diego Co., Pacific Beach [UCDC];San Diego Co., Mission Hills [UCDC];San Diego Co., Kate Sessions Park [UCDC];San Diego Co., Balboa Park [UCDC];San Diego Co., Point Loma [UCDC];San Joachin Co., Caswell State Park [PSWC];San Luis Obispo Co., Oso Flaco Lake [LACM];San Mateo Co., Colma [USNM];San Mateo Co., San Bruno Mt. [PSWC];Santa Clara Co., South Coyote [PSWC];Sonoma Co., Russian R. 6k E. Healdsburg [UCDC];Yolo Co., 6kW Capay [PSWC];Yolo Co., Davis [PSWC, UCDC];Yolo Co., Grasslands Regional Park, 8k SW Davis [PSWC, UCDC];Florida: Escambia Co., Gonzalez [MCZC];Louisiana: Plaquemines Co., Happy Jack [BMNH], Orleans Co., New Orleans [BMNH], Lousiana (s. loc.) [BMNH];Mississippi: Coahoma Co., Clarkesdale [USNM], Copiah Co., Hazelhurst [MCZC], Oktibbeha Co., Starkville [BMNH];South Carolina: York Co., York [BMNH].

 

. 1-7. Linepithema workers. 1. L. humile , lateral view. Specimen from Neembucu, Paraguay. 2. Undescribed Linepithema species, mesosoma, lateral view. Specimen from Parque Nacional El Palmar, Entre Rios, Argentina. 3. L. iniquum , mesosoma, lateral view. Specimen from the Reserva Natural del Bosque Mbaracayua, Paraguay. 4. Undescribed Linepithema species, mesosoma, lateral view. Specimen from the Reserva Natural del Bosque Mbaracayu, Canindeyu, Paraguay. 5. L. humile , head, full face view, same specimen as 1. 6. L. oblongum , head, full face view. Specimen from Infiernillos, Tucumaan, Argentina. 7. Undescribed Linepithema species, head, full face view. Same specimen as in Fig. 2.

 

Worker Measurements. HOLOTYPE: HL 0.74, HW 0.66, MFC 0.16, SL 0.76, FL 0.65, LHT 0.68, PW 0.45, ES 2.93, SI 115, CI 89.

 

Others (n = 81): HL 0.62-0.78, HW 0.53-0.72, MFC 0.14-0.18, SL 0.62-0.80, FL 0.52-0.68, LHT 0.57-0.76, PW 0.35-0.47, ES 1.98-3.82, SI 108-126, CI 84-93.

 

Worker Diagnosis. A large (HL> 0.62 mm) slender Linepithema . Head in full-face view longer than broad (CI 84-93), narrowed anteriorly and reaching its widest point just posterior to the compound eyes. Lateral margins broadly convex, grading smoothly into posterior margin. Posterior margin of head straight in smaller workers to weakly concave in larger workers. Compound eyes large (ES 1.98-3.82), comprising 82- 110 ommatidia (normally around 100). Antennal scapes long (SI 108-126), as long or slightly longer than HL and easily surpassing posterior margin of the head in full-face view. Maxillary palpi relatively short, segments 4 and 5 both noticeably shorter than segment2.

 

Pronotum and mesonotum forming a continuous convexity in lateral view, mesonotal dorsum nearly straight, not angular or strongly impressed, although sometimes with a slight impression in the anterior half.

 

Metanotal groove moderately impressed. Propodeum in lateral view inclined anteriad. In lateral view, dorsal propodeal face meeting declivity in a distinct though obtuse angle, from which the declivity descends in a straight line to the level of the propodeal spiracle.

 

Dorsum of head, mesosoma, petiole, and abdominal tergites 3 and 4 (= gastric tergites 1 and 2) devoid of erect setae (very rarely with a pair of small setae on abdominal tergite 4). Clypeus bearing a pair of long, forward-projecting setae. Abdominal tergites 5 and 6 each bearing a pair of long, erect setae. Ventrum of metasoma with scattered erect setae. Gula with a pair of short setae. Body and appendages, including gula, the entire mesopleuron, and abdominal tergites, covered in dense pubescence.

 

Country Admin. Argentina Buenos AiresLocality BocaStatusLatitude Longitude 34° 38' S58° 21'Collection ALWCArgentina Buenos AiresBuenos Aires34° 36' S58° 28' WBMNH, MHNG, NHMB, NHMW, UCDCArgentina Buenos AiresCampana34° 12' S58° 56' WALWCArgentina Buenos AiresReserva Costanera Sur34° 07' S58° 21' WAVSCArgentina Buenos AiresIsla Martin Garcia34° 21' S58° 16' WMACN, NHMBArgentina Buenos AiresLa Plata34° 56' S57° 57' WNHMBArgentina Buenos AiresLima-Zarete34° 03' S59° 12' WIFMLArgentina Buenos AiresOlivos34° 31' S58° 30' WMACNArgentina Buenos AiresReserva Otamendi34° 14' S58° 54' WALWC, AVSC, IFMLArgentina Buenos AiresRosas- F.C.Sud35° 58' S58° 56' WMACNArgentina Buenos AiresSanta Coloma34° 26' S59° 02' WALWCArgentina ChubutRawson43° 18' S65° 06' WPSWCArgentina CorrientesAyo. Cuay Grande28° 47' S56° 17' WALWCArgentina CorrientesCorrientes27° 28' S58° 50' WMACNArgentina CorrientesIta Ibate27° 25' S57° 10' WAVSCArgentina CorrientesPort Alvear29° 07' S56° 33' WAVSCArgentina CorrientesSto. Tome28° 33' S56° 03' WIFMLArgentina Entre Rios10k S Medanos33° 29' S58° 52' WALWCArgentina Entre RiosColon32° 15' S58° 07' WAVSCArgentina Entre RiosDiamante32° 01' S60° 39' WALWCArgentina Entre RiosEst. Sosa31° 44' S59° 55' WMACN, MHNG, NHMBArgentina Entre RiosParque Nacional El Palmar31° 53' S58° 13' WAVSCArgentina Entre RiosParque Nacional Pre Delta32° 7' S60° 38' WAVSCArgentina Entre RiosPort Ibicuy33° 48' S59° 10' WAVSCArgentina Entre RiosVictoria32° 38' S60° 10' WALWCArgentina Entre RiosVillaguay31° 51' S59° 01' WNHMBArgentina FormosaClorinda25° 17' S57° 43' WIFMLArgentina FormosaFormosa26° 11' S58° 11' WMACN, NHMBArgentina FormosaMojon de Fierro26° 03' S58° 03' WIFMLArgentina La RiojaAmingai28° 50' S66° 54' WALWC, IFMLArgentina La RiojaChuquis28° 54' S66° 58' WALWCArgentina MisionesParque Nacional Iguazui25° 42' S54° 26' WIFMLArgentina MisionesPosadas27° 23' S55° 53' WMZSPArgentina Santa Fe10k E Santa Fe, Ruta 16831° 41' S60° 34' WALWCArgentina Santa FeFives Lille30° 09' S60° 21' WNHMBArgentina Santa FePort Ocampo28° 30' S59° 16' WAVSCArgentina Santa FeRosario32° 57' S60° 40' WMACNArgentina Tucumai nTichuco26° 31' S65° 15' WALWCBrazil AmazonasManaus03° 07' S60° 02' WMZSPBrazil GoiasAnapolis16° 20' S48° 58' WMZSPBrazil Mato Grosso do Sul Corumba Faz. Sta. Blanca19° 01' S57° 39' WMZSPBrazil Mato Grosso do Sul Corumba Pto. Esperanga19° 37' S57° 27' WMZSPBrazil Mato Grosso do Sul Passo do Lontra19° 34' S57° 01' WPSWC, UCDCBrazil Mato Grosso do Sul Pto. Murtinho21° 42' S57° 52' WMZSPBrazil Rio de JaneiroRio de Janeiro22° 54' S43° 14' WMCSN, MCZC, MHNGBrazil Rio Grande do SulN. Wurtemberg28° 18' S53° 30' WMZSPBrazil Rio Grande do SulPelotas31° 46' S52° 20' WBMNHChile La AraucaniaTemuco38° 44' S72° 36' WMZSPChile SantiagoSantiago, Metropolitan area33° 27' S70° 40' WAVSCChile Valparaiso10k E Vina del Mar33° 00' S71° 31' WAVSCColombia QuindioArmenia4° 30' S75° 42' WWPMCEcuador PichinchaCarapungo0° 05' S78° 30' WALWCEcuador PichinchaMitad del Mundo0° 00' S78° 27' WALWCEcuador PichinchaQuito0° 11' S78° 30' WQCAZParaguay Alto ParaguayPto. 14 de Mayo20° 23' S58° 08' WMCSNParaguay Asuncioi nAsuncion25° 16' S57° 40' WIFML, MACN, NHMB, USNMParaguay BoqueronP.N. Defensores del Chaco, Cerro Leon20° 25' S60° 20' WALWCParaguay CentralSan Lorenzo25° 20' S57° 31' WALWCParaguay CordilleraSan Bernadino25° 16' S57° 19' WMHNGParaguay N eembucuPilar26° 52' S58° 18' WALWCParaguay Neembucu26° 52' S57° 47' WALWCParaguay Pte. HayesBenjamin Aceval24° 58' S57° 34' WUSNMParaguay Pte. HayesRio Confuso, Ruta Trans-Chaco25° 06' S57° 33' WALWC, IBNPParaguay Pte. HayesVilla Hayes25° 06' S57° 34' WALWC, IBNPParaguay Pte. Hayes5k SE Pozo Colorado23° 33' S58° 46' WALWCParaguay Pte. HayesRt. 5 3k SE Concepcion23° 27' S57° 27' WALWCParaguay San PedroPto. Rosario24° 30' S57° 00' WALWCPeru LimaLos Condores12° 03' S77° 03' WMZSPUruguay ColoniaCarmelo33° 59' S58° 17' WMACN, NHMBUruguay ColoniaColonia de Sacramento34° 28' S57° 51' WAVSCUruguay MontevideoMontevideo34° 51' S56° 10' WMACN, NHMB, NHMW

 

Body and appendages concolorous, most commonly a medium reddish or yellowish brown but ranging in some populations from testaceous to dark brown, never yellow or piceous. Integument shagreened and lightly shining.

 

Worker Geographic Variation. Specimens from introduced populations outside of South America tend to fall toward the upper range of size variation in nearly all measurements, although there is considerable variation both in the native and the introduced ranges. The holotype worker from Buenos Aires is among the largest ants from either range. Some Paraguayan populations, particularly those farther than 10 km from the Paraguay River, have a slightly smaller eye size (<95 ommatidia) and tend to be smaller than ants in the southern Parana drainage and along the major riverways. In general, Paraguayan specimens vary more in color than specimens from elsewhere, from testaceous to dark brown. The diagnostically sparse pilosity is generally consistent across all specimens, but several workers from Campana, Buenos Aires, have small erect setae on abdominal tergite 4 (= gastric tergite 2). These Campana workers otherwise fall within the range ofvariation for L. humile , and males from the same series clearly belong to L. humile .

 

Queen Measurements. (n = 13) HL 0.83-0.92, HW 0.83-0.93, SL 0.81-0.89, WGL 4.42-4.51, WL 1.67- 2.09, FL 0.78-0.90, LHT 0.88-0.97, ES 7.3-9.4, SI 96- 102, CI 93-101.

 

Queen Diagnosis. A robust species, dificult to distinguish from queens ofrelated Linepithema , with long antennal scapes and large eyes. Head in full face view normally somewhat longer than broad (CI 93-101), lateral margins convex and broadly curved into the posterior margin. Posterior margin ofhead straight to slightly concave, never deeply or conspicuously concave. Eyes large (ES 7.3-9.4). Antennal scapes long (SI 96 -102) and nearly equal to head length.

 

Entire body covered in a dense pubescence, a bit thicker and longer than that of the worker. Pilosity is also more developed than in the worker, with 2-11 (mean = 6) erect setae on the mesoscutum, 1-7 (mean = 4) erect setae on the scutellum, and 1-10 (mean = 3) erect setae on abdominal tergite 3, including the posterior row. Color as for the worker.

 

Queen Geographic Variation. Alate queens are much more common in collections from the native range than in collections from outside of South America. This observation is unlikely to be a sampling artifact given how heavily the introduced populations are represented in collections.

 

Male Measurements. (n = 25) HL 0.56-0.71, HW 0.56-0.74, SL 0.13-0.16, MML 1.40-1.96, MMW 0.76- 1.12, WGL 2.55-3.26, FL 0.60-0.77, LHT 0.51-0.66, SI 12.8-15.4, CI 98.2-106.0.

 

Male Diagnosis. A robust ant, larger than the worker, with an exceptionally well-developed mesosoma. Head about as broad as long in full face view (CI 98.2-106.0) and somewhat dorso-ventrally compressed in lateral view. Eyes large, occupying much of antero-lateral surface of head and forming the anterior margin ofthe head lateral to the clypeus and the lateral margin of the head anterior to midpoint. Ocelli large and in full frontal view set above the adjoining postero-lateral margins. Anterior clypeal margin straight to broadly convex. Mandibles small, having a single apical tooth and four to eight denticles along the masticatory margin and rounding into the inner margin. Masticatory margin relatively short, about the same length as the inner margin. Inner margin roughly parallel to, or even converging distally with, the exterior lateral margin.

 

Mesosoma well-developed, considerably wider than head width, and larger in bulk and in length than metasoma. Mesoscutum greatly enlarged, projecting forward in a convexity overhanging the pronotum. Scutellum large, convex, nearly as tall as mesoscutum and projecting well above the level ofthe propodeum. Propodeum overhanging petiolar node, and declivitous face strongly concave.

 

Wings short relative to mesosomal length (Fig. 17) and bearing a single submarginal cell. Wing color whitish or yellowish, with dark brown veins and stigma. Petiolar scale with a broad crest and taller than the length of the node. Ventral process well developed. Gaster oval in dorsal view, nearly twice as long as broad. Parameres terminating as rounded pilose lobes. Digitus short, with a sharp, downturned terminal ilament.

 

Dorsal surfaces of body largely devoid of erect setae, occasionally with a few ine, short setae scattered on mesoscutum, scutellum, and posterior abdominal tergites. Venter of gaster with scattered setae. Pubescence dense on body and appendages, becoming sparse only on the medial propodeal dorsum. Color as for the worker.

 

Male Geographic Variation. As in workers, specimens from introduced populations outside of South America tend to fall in the upper range of size variation.

 

Discussion

 

Taxonomy. These taxonomic results support current nomenclatural use. The holotype worker of Mayr's Hypoclinea humilis falls neatly within the range of variation present in the Argentine ant both in South America and in locations around the world where the ant is invasive (Figs. 15 and 16). The only older species-level name in the genus, Linepithema fuscum Mayr 1866, pertains to a male ant whose slender build, elongate genitalia, and distinct queen-like wing venation indicate only a distant relation to L. humile . Borgmeier's species riograndense , described from Rio Grande do Sul, Brazil, is clearly conspecific with L. humile and is synonymized here. Borgmeier's specimen identifications in MZSP reveal that he considered the name humile to apply to a common, probably undescribed southern Brazilian Linepithema with short antennal scapes and more extensive pilosity. The aptly named subspecies L. humile arrogans Chopard , described from introduced L. humile populations in southern France, was probably inadvertently resurrected by Shattuck (1992) from an earlier synonymy. Here, I return arrogans to synonymy because there is no reason to view introduced Argentine ant populations as being heterospeciic.

 

Diagnosis . L. humile diagnosis is straightforward in the male caste. The distinctive bulky males of humile are not easily confused with males of any other species. Males of closely related forms share structural similarities with L. humile (e.g., the undescribed species in Fig. 14) but are considerably smaller (Fig. 17) with a much less developed mesosoma. The lack of known intergrades strongly supports the speciic status of L. humile . The only other congeneric males that share the size of humile are montane Andean and Caribbean forms associated with L. fuscum , but these are unlikely to be confused with L. humile . Linepithema fuscum -group males are structurally divergent (Shattuck 1992), with an unusually elongate habitus, a propodeum with a convex posterior face in lateral view, two submarginal cells in the forewing, and considerably longer wings relative to maximum mesosomal length (Fig. 17).

 

Diagnosis is somewhat more problematic in workers, as no single character serves to separate L. humile from congeneric species. Table 2 provides a summary of the minimum combination of three character states that can diagnose nearly all L. humile worker specimens over the full geographic distribution of Linepithema . Figure 15 shows a consistent though not absolutely diagnostic difference in eye size versus head length between the large-eyed L. humile and all other non-humile specimens. Figure 16 plots antennal scape length versus head length in L. humile versus several other species, excluding the distinct long-scaped species L. oblongum , L. leucomelas , and ants of the L. iniquum -complex. These species are readily recognizable with other characters. Specifically, iniquum-complex ants have a strongly impressed mesonotal dorsum (Fig. 3), pronotal setae, and smaller eyes (ES <2.0). L. leucomelas has a distinct white/brown bicoloration reminiscent of the ant Tapinoma melanocephalum (F.) 1793, standing setae on gastric tergites 1 and 2, and smaller eyes (ES <2.0).

 

L. oblongum (Fig. 6) is the species most similar to L. humile . This poorly known ant seems to be conined to the high Andes in northern Argentina and Bolivia. Workers share the sparse pilosity and a similar mesosomal proile with L. humile , but they are somewhat more elongate (CI 81-88, mean = 84 in L. oblongum ; CI 84 -93, mean = 90 in L. humile ) and have relatively smaller eyes (Fig. 18). Linepithema oblongum workers also have a noticeably smoother and shinier integument on the gastric dorsum than L. humile , and most workers have only sparse pubescence on gastric tergites2 and 3, although some of the larger specimens within a series may retain a dense pubescence. Males of L. oblongum are much smaller than those of L. humile (MML <1.1), and they lack the extraordinary mesosomal development of L. humile males. This species may be the sister taxon of the Argentine ant, a possibility that is currently being pursued with molecular genetic data (unpublished data).

 

. The Argentine ant's native distribution seems to be limited to the Parana River drainage (Fig. 19), conirming the conclusion of Tsutsui et al. (2001). South American records of L. humile outside the Paranaa drainage are invariably from urban areas, an observation that strongly supports the notion of recent introduction by human commerce. Paranaa drainage records are also more abundant than nonParanaa records (49 versus 8). Furthermore, most records fall within a few kilometers of the largest rivers: the Parana, the Paraguay, and the Uruguay. This is unlikely to be a sampling artifact, as evidenced from numerous records of other, non-humile species distant from major rivers (Fig. 20).

 

Records of L. humile in South America show the following pattern: patchy local abundance in low areas of the Parana River drainage; common along major rivers (perhaps aided through frequent natural dispersal along the river); and very recent dispersal out of the Parana drainage with human activity. Interestingly, some of the more morphologically divergent L. humile , including those with color variations and smaller compound eyes, are found>10 kilometers away from large rivers in the northern part of the native range. It is unlikely that this variation reflects the existence ofcryptic species, given that much ofthe variation is allopatric and that L. humile males show remarkable consistency in diagnostic traits across populations. Specimens from the southern native range tend to look more like the common pest L. humile , although there is still a fair amount of variation. Overall this pattern raises the hypothesis of a northern origin for the species with later dispersal along the rivers. This hypothesis could be tested with genetic data in a phylogeographic framework (Avise 2000).

 

The history and biology of the Argentine ant in its native range is liable to be complex. Argentine ants likely move along river channels during periods of natural disturbance, and some of the native range records probably correspond to recent local introductions through human commerce. It bears noting that L. humile is present in many urban areas along the Paranaa and Paraguay rivers. The preponderance of Argentine ant records from lat, expansive lood plains suggests that records from fast-running, deeply channelized stretches of the Upper Parana such as Argentina's Foz do Iguacu also may not represent native populations.

 

The morphological diversity in native-range L. humile raises the issue of intraspeciic diversity in other aspects of Argentine ant biology. Tsutsui and Case (2001) note variation in colony structure in the native range, and there also may be variation in mating systems and in colony life history. Studies that make use of contrasts between Argentine ant biology between native and introduced ranges would do well not to treat native range L. humile as a monolithic entity.

 

Rather, care should be taken to chose L. humile populations that are most likely to be close relatives of the introduced populations under study. Genetic work of Tsutsui et al. (2001) indicates that a southern Parana population represents the source population for California L. humile . It also remains a possibility that some biological changes that contribute to the Argentine ants' invasive success occurred within the native range before introduction. Detailed studies ofArgentine ant biology mapped onto a population-level phylogeny over the whole of the native range could determine if this were the case, as well as shed light on the sequence of evolutionary events leading to invasiveness in Argentine ants.

License not applicable

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

I [introduced species]

License not applicable

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hypoclinea humilis Mayr 1868: 164 (W). Holotype worker, Buenos Aires, Argentina, Stroebel, 1866 [NHMW, examined].

 

Iridomyrmex humilis (Mayr) . Emery 1888: 386-388. First combination in Iridomyrmex .

 

Iridomyrmex humilis (Mayr) . Wheeler 1913a: 27-29 (M, Q, W). Male and queen description, worker redescription.

 

Iridomyrmex humilis (Mayr) . Newell and Barber 1913: 38-39 (egg), 40-41 (larva), 42-45 (W, M, Q pupae).

 

Iridomyrmex humilis var. arrogans Chopard 1921: 241-245 (W). Lectotype worker, by present designation [NHMB, examined], Cannes, Provence-Alpes-Cote d'Azur, France, Chopard [NHMB, examined]. Junior synonym of I. humilis by Bernard 1967: 251. Restored to subspecies of L. humile (Mayr) by Shattuck 1992a: 16. Returned to synonymy by Wild 2004: 1207.

 

Iridomyrmex riograndensis Borgmeier 1928: 64 (W). Lectotype worker, by present designation [MZSP, examined] and 7 worker paralectotypes, Rio Grande do Sul (s.loc.), Brazil, 19.i.1918 [MZSP, examined]. Junior synonym of L. humile (Mayr) by Wild 2004: 1207.

 

Iridomyrmex humilis (Mayr) . Wheeler and Wheeler 1951: 186-189. Summary of larval biology.

 

Iridomyrmex humilis (Mayr) . Crozier 1969: 250. Karyotype.

 

Linepithema humile (Mayr) . Shattuck 1992a: 16. First combination in Linepithema .

 

Linepithema humile arrogans (Chopard) . Shattuck 1992a: 16. First combination in Linepithema .

 

Linepithema riograndensis (Borgmeier) . Shattuck 1992a: 16. First combination in Linepithema .

 

Linepithema humile (Mayr) . Shattuck 1994: 123.

 

Linepithema humile arrogans (Chopard) . Shattuck 1994: 123.

 

Linepithema riograndensis (Borgmeier) . Shattuck 1994: 127.

 

Linepithema humile (Mayr) . Bolton 1995: 247.

 

Linepithema humile arrogans (Chopard) . Bolton 1995: 246.

 

Linepithema riograndensis (Borgmeier) . Bolton 1995: 247.

 

Linepithema humile (Mayr) . Wild 2004: 1204-1215 (M, Q, W). Distribution and taxonomic redescription.

 

worker measurements: HL 0.74, HW 0.66, MFC 0.16, SL 0.76, FL 0.65, LHT 0.68, PW 0.45, ES 2.93, SI 115, CI 89, CDI 24, OI 40.

 

Worker measurements: (n = 81) HL 0.62-0.78, HW 0.53-0.72, MFC 0.14-0.18, SL 0.62-0.80, FL 0.52-0.68, LHT 0.57-0.76, PW 0.35-0.47, ES 1.98-3.82, SI 108-126, CI 84-93, CDI 23-28, OI 32-49.

 

Worker diagnosis: Eyes large (OI> 30); antennal scapes long (SI> 105); pronotum and first two gastric tergites lacking erect setae; mesopleura and metapleura densely pubescent.

 

Worker description: Head in full face view longer than broad (CI 84-93), narrowed anteriorly and reaching its widest point just posterior to compound eyes. Lateral margins broadly convex, grading smoothly into posterior margin. Posterior margin straight in smaller workers to weakly concave in larger workers. Compound eyes large (OI 32-49), comprising 82-110 ommatidia (normally around 100). Antennal scapes long (SI 108-126), as long or slightly longer than HL and easily surpassing posterior margin of the head in full face view. Frontal carinae narrowly to moderately spaced (CDI 23-28). Maxillary palps relatively short, shorter than Vi HL, ultimate segment (segment six) noticeably shorter than segment 2.

 

Pronotum and mesonotum forming a continuous convexity in lateral view, mesonotal dorsum nearly straight, not angular or strongly impressed, although sometimes with a slight impression in anterior portion. Metanotal groove moderately impressed. Propodeum in lateral view inclined anteriad. In lateral view, dorsal propodeal face meeting declivity in a distinct though obtuse angle, from which the declivity descends in a straight line to the level of the propodeal spiracle.

 

Petiolar scale sharp and inclined anteriorly, in lateral view falling short of the propodeal spiracle.

 

Dorsum of head (excluding clypeus), mesosoma, petiole, and gastric tergites 1-2 (= abdominal tergites 3-4) devoid of erect setae (very rarely with a pair of small setae on gastric tergite 2). Gastric tergites 3-4 each bearing a pair of long, erect setae. Venter of metasoma with scattered erect setae.

 

Integument shagreened and lightly shining. Body and appendages including gula, entire mesopleura, metapleura, and abdominal tergites covered in dense pubescence.

 

Body and appendages concolorous, most commonly a medium reddish or yellowish brown but ranging in some populations from testaceous to dark brown, never yellow or piceous.

 

measurements: (n = 13) HL 0.83-0.92, HW 0.83-0.93, SL 0.81-0.89, FL 0.78-0.90, LHT 0.88-0.97, EL 0.31-0.36, MML 1.67-2.09, WL 4.42-4.51, CI 93- 101, SI 96-102, OI 36-39, WI 24-27, FI 40-48.

 

Queen description: Moderately large species (MML 1.67-2.09). Head slightly longer than broad to as broad as long in full face view (CI 93-101), posterior margin slightly concave to slightly convex. Eyes of moderate size (OI 36-39). Ocelli small. Antennal scapes relatively long (SI 96-102), in full face view scapes in repose surpassing posterior margin by a length greater than length of first funicular segment.

 

Forewings short relative to mesosomal length (WI 24-27). Forewings with Rs+M at least three times longer than M.f2. Legs of moderate length relative to mesosomal length (FI 40-48).

 

Dorsum of mesosoma and metasoma with scattered standing setae. Mesoscutum bearing 2-11 standing setae. Body color medium reddish brown. Antennal scapes, legs, and mandibles concolorous with body.

 

Male measurements: (n = 12) HL 0.56-0.70, HW 0.56-0.74, SL 0.13-0.16, FL 0.60- 0.77, LHT 0.51-0.66, EL 0.31-0.34, MML 1.40-1.96, WL 2.55-3.26, PH 0.25-0.34, CI 99-106, SI 22-27, OI 51-55, WI 17-20, FI 37-45.

 

Male diagnosis: Forewing with single submarginal cell; mesosoma robust (MML> 1.3), mesoscutum greatly enlarged and overhanging pronotum; wings short relative to mesosomal length (WI <21).

 

Male description: Head about as broad as long in full face view (CI 99-106). Eyes large (OI 51-55), occupying much of anterolateral surface of head and separated from posterolateral clypeal margin by a length less than width of antennal scape. Ocelli large and in full frontal view set above adjoining posterolateral margins. Antennal scape of moderate length (SI 22-27), about 2/3 length of 3rd antennal segment. Anterior clypeal margin straight to broadly convex. Mandibles small, bearing a single apical tooth and 4-8 denticles along masticatory margin and rounding into inner margin. Masticatory margin relatively short, subequal in length to inner margin. Inner margin roughly parallel to, or converging distally with, exterior lateral margin.

 

Mesosoma unusually well developed, considerably wider than head width, and larger in bulk and in length than metasoma. Mesoscutum greatly enlarged, projecting forward in a convexity overhanging pronotum. Scutellum large, convex, nearly as tall as mesoscutum and projecting well above level of propodeum. Propodeum well developed and overhanging petiolar node, posterior propodeal face strongly concave. Forewings short relative to mesosomal length (WI 17-20) and bearing a single submarginal cell. Wing color whitish or yellowish with dark brown veins and stigma. Legs short relative to mesosoma length (FI 37-45).

 

Petiolar scale taller than node length and bearing a broad crest. Ventral process well developed. Gaster oval in dorsal view, nearly twice as long as broad. Gonostylus produced as a bluntly rounded pilose lobe. Volsella with cuspis present, digitus short and downturned distally.

 

Dorsal surfaces of body largely devoid of erect setae, occasionally with a few fine, short setae scattered on mesoscutum, scutellum, and posterior abdominal tergites. Venter of gaster with scattered setae. Pubescence dense on body and appendages, becoming sparse only on medial propodeal dorsum.

 

Color as for worker.

 

Distribution: Native to the Parana river drainage of Brazil, Paraguay, Argentina, and Uruguay. Introduced worldwide.

 

Biology: This important pest species has a literature too extensive to be covered in depth here. An early general review of the biology of this ant is given by Newell and Barber (1913). The spread of Argentine ants around the world is documented by Roura-Pascual et al. (2004), Wild (2004), Giraud et al. (2002), and Suarez et al.

 

(2001). Ecological impacts of Argentine ant invasion have been detailed in numerous studies, including Suarez and Case (2003), Touyama et al. (2003), Christian (2001), and Human and Gordon (1997). Colony structure has also received considerable attention, and relevant papers include Holway and Suarez (2004), Tsutsui and Case (2001), Reuter et al. (2001), and Kreiger and Keller (2000). A series of studies by Cavill and colleagues (Cavill and Houghton 1973, Cavill and Houghton 1974, Cavill et al. 1980) describe some of the glandular and cuticular chemistry of L. humile . Chemical and biological control options are reviewed by Harris (2002).

 

Of the L. humile material examined, more than 90% of native range records are within 10 kilometers of a major river in the Parana drainage. Contrary to some reports (Buczkowski et al. 2004), L. humile can reach high densities in urban areas in Argentina and Paraguay (Wild 2004) as well as in less disturbed habitats (Heller 2004). Where nest information was recorded in the native range, 24 nests are from soil, five from under covering objects such as stones or garbage, one from an old termite mound, and one from under bark. This species is polygynous and polydomous, and many nests are recorded as having numerous dealate queens. In contrast to introduced populations, alate queens are not uncommon in nests in Argentina (Wild 2004). One observation in Victoria, Argentina, notes a live lycaenid larva in the brood nest (Wild, pers. obs.).

 

species: Workers of the sister species L. oblongum , from the high Andes of Bolivia and northern Argentina, normally have at least some members of each series with dilute pubescence on gastric tergites 2-4. These ants also have, on average, smaller eyes (OI 28-38, Fig. 86) and longer antennal scapes (SI 120-139, Fig. 85) than L. humile . Workers of L. anathema, a rarely-collected Brazilian species, have a more produced propodeum (Fig. 33), a narrow head (CI <86), and usually bear short standing setae on gastric tergites 1-2. Workers of other Humile-group species have shorter antennal scapes and often bear erect setae on the pronotum and basal gastric tergites. Males of related species are much smaller than L. humile and lack the greatly swollen mesosoma.

 

Discussion: The taxonomy and distribution of L. humile was recently reviewed in depth by Wild (2004).

 

Material examined: ARGENTINA. Buenos Aires: Boca, 34°38'S 58°21'W [ALWC];Buenos Aires, 34°36'S 58°28'W [BMNH, MHNG, NHMB, NHMW, UCDC];Campana, 34°12'S 58°56'W [ALWC, BMNH, CASC, MZSP];Reserva Costanera Sur, 34°07'S 58°21'W [AVSC];Isla Martin Garcia [MACN, NHMB];La Plata [NHMB];Lima-Zarete [IFML];Olivos [MACN];Reserva Otamendi, 34°14'S 58°54'W [ALWC, AVSC, IFML];Rosas- F.C.Sud [MACN];Santa Coloma, 34°26'S 59°02'W [UCDC].Chubut: Rawson, 43°18'S 65°06'W [PSWC].Corrientes: Ayo. Cuay Grande, 28°47'S 56°17'W [UCDC];Corrientes [MACN];Ita Ibate, 27°25'S 57°10'W [AVSC];Port Alvear, 29°07'S 56°33'W [AVSC];Sto. Tome, 28°33'S 56°03'W [IFML].Entre Rios: 10 km S Medanos, 33°29'S 58°52'W [ALWC, BMNH];Colon, 32°15'S 58°07'W [AVSC];Diamante, 32°01'S 60°39'W [ALWC];Est. Sosa [MACN, MHNG, NHMB];Parque Nacional El Palmar, 31°53'S 58°13'W [AVSC];Parque Nacional Pre Delta, 32°7'S 60°38'W [AVSC];Port Ibicuy, 33°48'S 59°10' [AVSC];Victoria, 32°38'S 60°10'W [ALWC];Villaguay [NHMB]. Formosa: Clorinda [IFML];Formosa [MACN, NHMB];Mojon de Fierro [IFML].La Rioja: Aminga, 28°50'S 66°54'W [ALWC, IFML, UCDC];Chuquis, 28°54'S 66°58'W [UCDC].Misiones: Parque Nacional Iguazu, 25°42'S 54°26'W [IFML];Posadas [MZSP].Santa Fe: 10 km E Santa Fe, Ruta 168, 31°41'S 60°34'W [ALWC, MCZC, USNM];Fives Lille [NHMB];Port Ocampo, 28°30'S 59°16'W [AVSC];Rosario [MACN].Tucuman: Tichuco, 26°31'S 65°15'W [UCDC].AUSTRALIA. New South Wales: Sydney [MZSP].Victoria (s. loc.) [BMNH].BELGIUM. Bruxelles Capitale: Brussels [BMNH, NHMB],Brussels Botanical Garden [MHNG].BERMUDA. Bermuda (s. loc.) [BMNH].BRAZIL. Amazonas: Manaus [MZSP].Goias: Anapolis [MZSP].Mato Grosso do Sul: Corumba, Faz. Sta. Blanca [MZSP];Corumba, Pto. Esperanca [MZSP];Passo do Lontra, 19°34'S 57°01'W [PSWC, UCDC];Pto. Murtinho [MZSP].Rio de Janeiro: Rio de Janeiro [MCSN, MCZC, MHNG].Rio Grande do Sul: N. Wurtemberg [MZSP];Pelotas [BMNH].Brazil (s.loc.), Port-of-entry U.S. intercept [ALWC, UCDC, USNM]. CAMEROON. Centre-Sud: Nkoemvom [BMNH]. CHILE . Bio-Bio: 3 km W Florida [UCDC]; Los Angeles, 37°26'S 72°19'W [UCDC].Coquimbo: Los Vilos [UCDC].La Araucania: Temuco [MZSP].Maule: 10 km E Curico [UCDC].Region Metropolitana: Talagante [UCDC].Santiago: Santiago, Metropolitan area, 33°27'S 70°40'W [AVSC].Valparaiso: 10 km E Vina del Mar, 33°00'S 71°31'W [AVSC];nr. El Melon, 1 km N of tunnel [UCDC].COLOMBIA. Quindio: Armenia [WPMC].ECUADOR. Pichincha: Carapungo, 00°05'S 78°30'W [ALWC, QCAZ];Mitad del Mundo, 00°00'S 78°27'W [ALWC, BMNH, MCZC];Quito, 00°11'S 78°30'W [QCAZ].FRANCE. Provence-Alpes-Cote d'Azur: Cannes [MCZC, NHMB],Castellane [BMNH],Hyeres [BMNH],Ste. Maxime [NHMB].Midi-Pyrenees: Toulouse [IFML].GERMANY. Berlin: Botanical Garden [MHNG].ITALY. Campania: nr. Naples [BMNH].Liguria: San Remo [NHMB].Sicilia: Palermo [BMNH].Toscana: Monte Argentario Giannella [BMNH];Orbetello [BMNH];Varazze (Savona) [MZSP].LESOTHO. Maseru: Maseru [BMNH].MOROCCO. Tanger: Tangier [USNM].MEXICO. Baja California: Ensenada, Cortera FR [AVSC].Baja California Sur: Guerrero Negro [AVSC].Distrito Federal: Mexico City [BMNH];Distrito Federal (s.loc.) [WPMC].Guanajuato: Guanajuato [ALWC].Mexico: 18 km SW Toluca [UCDC].NAMIBIA. Erongo: Swakopmund [BMNH].PARAGUAY. Alto Paraguay: Pto. 14 de Mayo [MCSN].Asuncion: Asuncion [IFML, MACN, NHMB, USNM].Boqueron: P.N. Defensores del Chaco, Cerro Leon [ALWC].Central: San Lorenzo, 25°20'S 57°31'W [ALWC].Cordillera: San Bernadino [MHNG].Neembucu: Pilar, 26°52'S 58°18'W [ALWC, MCZC];26°52'S 57°47'W [ALWC, LACM].Pte. Hayes: Benjamin Aceval [USNM];Rio Confuso, Ruta Trans-Chaco [ALWC, INBP];Villa Hayes, 25°06'S 57°34 W [ALWC, INBP, MCZC];5 km SE Pozo Colorado, 23°33'S 58°46' [ALWC, BMNH, INBP, MCZC, USNM];Rt. 5, 3 km SE Concepcion, 23°27'S 57°27'W [ALWC].San Pedro: Pto. Rosario, 24°30'S 57°00'W [ALWC, MZSP].PERU. Lima: Los Condores [MZSP].POLAND. Dolnoslaskie: Breslau [NMHB].PORTUGAL. Faro: Algarve, Luz nr. Lagos [BMNH].Lisboa: Cascais [USNM];Estoril [USNM];Lisbona [MCZC, NHMB];Mafra [USNM];Praia das Macas [USNM].Madeira: Funchal [MCZC, NHMB];Porto Moniz [BMNH];Ribeira Brava [BMNH];Ilheu Chao [BMNH];Porto Santo [BMNH];Sao Vicente [BMNH];Vale de Paraiso [BMNH];Praia Formosa [BMNH];Porto da Cruz [BMNH];Feiteiras [BMNH];Caramujo [BMNH];Lower Levada [BMNH],Madeira Is. (s. loc.) [BMNH, MHNG, NHMB].Porto: Leca [BMNH];Oporto [BMNH].SOUTH AFRICA. Eastern Cape: Queenstown [BMNH];Somerset East [BMNH].Mpumalanga: Nelspruit [BMNH].Northern Cape: Colesberg [ALWC, MCZC].Western Cape: Capetown [BMNH];Table Mt. [BMNH];nr. George [BMNH].SPAIN. Andalucia: Malaga [USNM].Canarias: Arenara [BMNH];Cruz de Tejeda [BMNH];Gran Canaria, Las Palmas, Telde [BMNH, MCZC, USNM];Orotava [BMNH];Santa Brigida [BMNH];Tenerife, Agua Mansa [NHMB];Tenerife, Ladera de Guimar [BMNH];Tenerife, Volcan de Guimar [NHMB];Tenerife (s. loc.) [BMNH].Cataluna: Playa de Aro [NHMB].Galicia: Mte. Ferro b. Bayona [BMNH].Islas Baleares: Minorca, Cala Forcat [BMNH].THAILAND. Port-of-entry U.S. intercept [USNM].UNITED KINGDOM. Edinburgh: Edinburgh [BMNH]. Sussex: Lewes [BMNH].Eastborne [BMNH].Exeter [BMNH].Windsor [BMNH].Glasgow [BMNH].W. Maidstone, Kent [BMNH].Chillingham [BMNH].Farnham House Lab, Imperial Bureau of Entomology [BMNH].U.S.A. Alabama: Lowdnes Co., Ft. Deposit [USNM].California: Alameda Co.,Berkeley [UCDC, USNM];Humboldt Co., Redway [ALWC, BMNH];Los Angeles Co., Pasadena [MZSP, USNM];Los Angeles Co.: Sta. Monica Mts, Big Rock Road, 34°02'N 118°37'W [UCDC];Monterrey Co., Big Sur [ALWC];Orange Co., Bolsa Chica Marsh [MZSP];Riverside Co., Lake Skinner Camp [AVSC];Sacramento Co., Sacramento [UCDC];San Diego Co., UC Elliot Reserve [AVSC];San Diego Co., San Diego [UCDC];San Diego Co., E. San Diego [UCDC];San Diego Co., Pacific Beach [UCDC];San Diego Co., Mission Hills [UCDC];San Diego Co., Kate Sessions Park [UCDC];San Diego Co., Balboa Park [UCDC];San Diego Co., Point Loma [UCDC];San Joachin Co., Caswell State Park [PSWC];San Luis Obispo Co., Oso Flaco Lake [LACM];San Mateo Co., Colma [USNM];San Mateo Co., San Bruno Mt. [PSWC];Santa Clara Co., South Coyote [PSWC];Sonoma Co., Russian R. 6 km E. Healdsburg [UCDC];Yolo Co., 6 km W Capay [PSWC];Yolo Co., Davis [PSWC, UCDC];Yolo Co., Grasslands Regional Park, 8 km SW Davis [PSWC, UCDC].Florida: Escambia Co., Gonzalez [MCZC].Louisiana: Plaquemines Parish., Happy Jack [BMNH];Orleans Parish, New Orleans [BMNH];Louisiana (s. loc.) [BMNH].Mississippi: Coahoma Co., Clarkesdale [USNM];Copiah Co., Hazelhurst [MCZC];Oktibbeha Co., Starkville [BMNH].South Carolina: York Co., York [BMNH].URUGUAY. Colonia: Carmelo [MACN, NHMB];Colonia de Sacramento, 34°28'S 57°51'W [AVSC].Montevideo: Montevideo [MACN, NHMB, NHMW].

License not applicable

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

(2, w; 8, w, m; 1 5, w; 2 3, w; 26, w; 31, w; 41, w; 44, w; 45, w). The Argentine ant is known from all the Canary Islands (Espadaler & Bernal, 2003). At El Hierro it occupies habitats from next to sea level to one thousand meters, in pine forests. Confronted with the two populations known to exist in North Mediterranean Europe (Giraud et al., 2002), the Argentine ants from El Hierro showed aggressiveness towards the Catalan population and reacted peacefully towards the Main population from mainland Europe. Aggression tests (one to one worker; five replicates) were run with two samples from El Hierro (La Frontera; Mirador de las Playas). I conclude that both samples from El Hierro belong to the genotypic profile of the Main population, the more abundant in Western Mediterranean Europe.

License not applicable

Espadaler, X.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Alto Paraguay, Boquerón , Central, Ñeembucú , Pte. Hayes, San Pedro, “ Paraná R.” (Dept. unknown) (ALWC, BMNH, IFML, INBP, MACN, MCSN, MCZC, MHNG, MZSP, NHMB). Literature records: Alto Paraguay, Boquerón , Central, Ñeembucú , Pte. Hayes, San Pedro (Wild 2004, Wild 2007).

License not applicable

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

[[ worker ]]. Basutoland, von Herrn Arnold erhalten. Es ist sehr interessant diese suedamerikanische Art aus Sued-Afrika zu erhalten. Sie gehoert zu den werdenden Kosmopoliten, die gegenwaertig im Begriff sind, siegreich die ganze Tropenwelt zu erobern. Ich konnte bisher ihren Eroberungszug in Madeira und Portugal historisch feststellen wie diejenigen der Plagiolepis longipes und des Brachymyrmex Cordemoyi in den Seychellen und Comoren etc.

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Linepithema iniquum, Iridomyrmex anceps

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Antkey

Source: Antkey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Linepithema humile

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 34
Specimens with Barcodes: 80
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Linepithema humile

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 24 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTATAATTGGTGGTTTTGGTAATTTCTTAGTACCACTAATA---TTAGGAGCCCCAGATATAGCATACCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCTTCAATTTTACTTTTAACTATTAGAAATTTTATTGGCACAGGTGTTGGTACAGGGTGAACAGTTTATCCTCCTTTAGCAGCAAACATATACCATAGCGGACCATCCGTTGATTTA---GCCATCTTCTCTTTACACATTGCAGGAATATCTTCTATTTTAGGGGCAATCAATTTTATCTCAACAATTCTAAATATACACCATAAAAATTTTTCTATTGACAAAATCCCTCTTTTAGTTTGATCAATTCTAATTACAGCTGTATTATTGCTTTTATCTTTACCTGTTTTAGCAGGA---GCAATTACAATACTTTTAACTGACCGAAATCTAAATACATCATTCTTTGATCCTTCAGGAGGAGGAGACCCAATTTTATACCAACACCTATTTTGATTTTTTGGACATCCCGAAGTATATATTTTAATTCTCCCAGGATTTGGATTAATCTCCCATATCATTATAAATGAAAGAGGAAAAAAA---GAAACATTTGGATCCTTAGGAATAATCTATGCTATAATTGCCATTGGATTCTTAGGATTTGTAGTTTGAGCACATCATATATTTACCATTGGTCTTGATGTAGATACACGAGCTTATTTTACATCTGCAACTATAATTATTGCTATCCCTACAGGTATTAAAATTTTTAGATGAATTACT---ACTCTTCATGGAACT---AAAATTAATTACAACCCTACTCTCTGATGAGCAATAGGATTTATTTTTTTATTTACTATAGGGGGGTTAACCGGAATTATACTTTCTAATTCATCAATTGACATTGTTCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Argentine ants are significant ecological, agricultural, and urban/residential pests.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Antkey

Source: Antkey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Argentine ant

The Argentine ant, Linepithema humile (formerly Iridomyrmex humilis), is a dark ant native to northern Argentina, Uruguay, Paraguay, and southern Brazil. It is an invasive species that has been established in many Mediterranean climate areas,[1] inadvertently introduced by humans to many places, including South Africa, New Zealand, Japan, Easter Island, Australia, Hawaii, Europe, and the United States.

Description[edit]

The worker ants are about 3 millimetres (0.12 in) long and can easily squeeze through cracks and holes no more than 1 millimetre (0.039 in) in size. Queens are two to four times the length of workers. These ants will set up quarters in the ground, in cracks in concrete walls, in spaces between boards and timbers, even among belongings in human dwellings. In natural areas, they generally nest shallowly in loose leaf litter or beneath small stones, due to their poor ability to dig deeper nests. However, if a deeper nesting ant species abandons their nest, Argentine ant colonies will readily take over the space.

German entomologist Dr. Gustav L. Mayr identified the first specimens of Hypoclinea humilis in the vicinity of Buenos Aires, Argentina in 1866. This species was shortly transferred to the genus Iridomyrmex, and finally to Linepithema in the early 1990s. The Argentine Ant is often confused with a related species ant species, the Pharaoh Ant (Monomorium pharaonis).

Distribution[edit]

The native range of Argentine ants is limited to around major waterways in the lowland areas of the Paraná River drainage; They have recently spread into parts of Argentina, Brazil, Chile, Colombia, Ecuador, and Peru.[2] The species has become established in at least 15 countries throughout the world, on six continents, as well as many oceanic islands.[3]

Global "mega-colony"[edit]

According to research published in Insectes Sociaux in 2009, it was discovered that ants from three Argentine ant supercolonies in America, Europe, and Japan, that were previously thought to be separate, were in fact most likely to be genetically related. The three colonies in question were one in Europe, stretching 6,000 km (3,700 mi) along the Mediterranean coast, the "Californian large" colony, stretching 900 km (560 mi) along the coast of California, and a third on the west coast of Japan.

Based on a similarity in the chemical profile of hydrocarbons on the cuticles of the ants from each colony, and on the ants' non-aggressive and grooming behaviour when interacting, compared to their behaviour when mixing with ants from other super-colonies from the coast of Catalonia in Spain and from Kobe in Japan, researchers concluded that the three colonies studied actually represented a single global super-colony.

The researchers stated that "enormous extent of this population is paralleled only by human society", and had probably been spread and maintained by human travel.[4]

Behavior[edit]

Argentine ants on a dead horse-fly

They have been extraordinarily successful, in part, because different nests of the introduced Argentine ants seldom attack or compete with each other, unlike most other species of ant. In their introduced range, their genetic makeup is so uniform that individuals from one nest can mingle in a neighboring nest without being attacked. Thus, in most of their introduced range, they form supercolonies. "Some ants have an extraordinary social organization, called unicoloniality, whereby individuals mix freely among physically separated nests. This type of social organization is not only a key attribute responsible for the ecological domination of these ants, but also an evolutionary paradox and a potential problem for kin selection theory because relatedness between nest mates is effectively zero."[5] In contrast, native populations are more genetically diverse, genetically differentiated (among colonies and across space), and form colonies that are much smaller than the supercolonies that dominate the introduced range. Argentine ants in their native South America also co-exist with many other species of ants, and do not attain the high population densities that characterize introduced populations.[6]

In a series of experiments, ants of the same colony were isolated and fed different diets. The hydrocarbons from the diet were eventually incorporated into the cuticle of the subjects. Those that had the same diet appeared to recognize one another as kin. Those who had at least some overlap in dietary composition also appeared to react non-aggressively to one another. These interactions contrasts drastically with the groups that fed on completely different sources, such as those who lived off flies and those that fed on grasshoppers. The groups appeared to have incorporated hydrocarbons that were not similar to the others and created an unfamiliar identity cue. These groups reacted violently towards each other This suggests that dietary factors affects the recognition cues for colony members.[7][8]

Reproduction and Seasonal Colony Trends[edit]

Relative biomass (in %) of workers to colony, calculated from a monthly sampling of 1000 random colony inhabitants over one year.

Like workers in many other ant species, Argentine ant workers are unable to lay reproductive eggs but can direct the development of eggs into reproductive females; the production of males appears to be controlled by the amount of food available to the larvae.[9] Argentine ant colonies almost invariably have many reproductive queens, as many as eight for every 1,000 workers. The queens seldom or never disperse in winged form. Instead, colonies reproduce by budding off into new units. As few as ten workers and a single queen can establish a new colony.

The seasonal low occurs in mid-winter, when 90% of a representative colony consisted of workers and the remainder of queens, and no reproductive activity and minimal birthing. Eggs are produced in late-winter, nearly all of which hatch into sexual forms by May. Mating occurs after the females emerge. Worker production increases steadily from mid-March to October, after which their numbers are not replenished; thus, their numbers drop steadily over the winter months.[10]

Colonies in the Argentine ant’s native habitat are kept within a range of ten to one hundred meters by colonies of interspecific and intraspecific rivals. As the colonies expand, they appear to form fluctuating territory borders, which contract and expand on a seasonal and conditional basis. There is an expansive push outward in the summer months, with a retreating motion in the winter. This has to do with soil moisture and temperature conditions.[11] At the edges of these borders are either rival Linepithema humile colonies or other obstacles that prevent further expansion, such as an inhospitable environment for nesting.[11]

Impact[edit]

The ants are ranked among the world's 100 worst animal invaders.[12] In its introduced range, the Argentine ant often displaces most or all native ants. This can, in turn, imperil other species in the ecosystem, such as native plants that depend on native ants for seed dispersal, or lizards that depend on native ants for food. For example, the recent severe decline in coastal horned lizards in southern California is closely tied to Argentine ants displacing native ant species on which the lizards feed.[13]

Argentine ants sometimes tend aphid colonies,[14] and their protection of this plant pest can cause problems in agricultural areas by protecting plant pests from predators and parasitoids.[15] In return for this protection, the ants benefit by feeding off an excretion known as honeydew. Thus, when Argentine ants invade an agricultural area, the population densities of these plant parasites increase and so too does the damage they cause to crops.

Pest control[edit]

Argentine ants accessing a commercial bait station commonly available in the United States. Within two days of this photograph, the ant colony appeared to have been destroyed and had ceased to access the five bait stations that had been placed for them.

Argentine ants are a common household pest, often entering structures in search of food or water (particularly during dry or hot weather), or to escape flooded nests during periods of heavy rainfall. When they invade a kitchen, it is not uncommon to see two or three queens foraging along with the workers. Eliminating a single queen does not stop the colony's ability to breed.

Due to their nesting behavior and presence of numerous queens in each colony, it is generally impractical to spray Argentine ants with pesticides or to use boiling water as with mound building ants. Spraying with pesticides has occasionally stimulated increased egg-laying by the queens, compounding the problem.[16] Pest control usually requires exploiting their omnivorous dietary habits, through use of slow-acting poison bait, which will be carried back to the nest by the workers, eventually killing all the individuals, including the queens. It may take four to five days to eradicate a colony in this manner.

Researchers from the University of California, Irvine, have developed a way to use the scent of Argentine ants against them.[17] The exoskeletons of the ants are covered with a hydrocarbon-laced secretion. They made a compound that is different, but similar, to the one that coats the ants. If the chemical is applied to an ant, the other members of the colony will kill it.[18] The chemical method may be effective in combination with other methods.

Another approach for a large scale control of the Argentine ant has been proposed by researchers from Japan, who showed that it is possible to disrupt its trails with synthetic pheromones.[19] This has been confirmed in various later trials by a New Zealand-led team in Hawaii [20] and by researchers from Victoria University of Wellington who showed that this approach is beneficial for other local ant species.[21]

References[edit]

  1. ^ Neil D. Tsutsui, Andrew V. Suarez, David A. Holway & Ted J. Case (2001). "Relationships among native and introduced populations of the Argentine ant (Linepithema humile) and the source of introduced populations" (PDF). Molecular Ecology 10 (9): 2151–2161. doi:10.1046/j.0962-1083.2001.01363.x. PMID 11555258. 
  2. ^ Alexander L. Wild (2004). "Taxonomy and distribution of the Argentine ant, Linepithema humile (Hymenoptera: Formicidae)" (PDF). Annals of the Entomological Society of America 97 (6): 1204–1215. doi:10.1603/0013-8746(2004)097[1204:TADOTA]2.0.CO;2. 
  3. ^ Andrew V. Suarez, David A. Holway & Ted J. Case (2001). "Patterns of spread in biological invasions dominated by long-distance jump dispersal: Insights from Argentine ants". Proceedings of the National Academy of Sciences 98 (3): 1095–1100. Bibcode:2001PNAS...98.1095S. doi:10.1073/pnas.98.3.1095. JSTOR 3054827. 
  4. ^ Walker, Matt (1 July 2009). "Ant mega-colony takes over world". Earth News (BBC News). Archived from the original on 2 July 2009. Retrieved 2 July 2009. 
  5. ^ Tatiana Giraud, Jes S. Pedersen & Laurent Keller (2002). "Evolution of supercolonies: the Argentine ants of southern Europe". Proceedings of the National Academy of Sciences 99 (9): 6075–6079. Bibcode:2002PNAS...99.6075G. doi:10.1073/pnas.092694199. JSTOR 3058627. PMC 122904. PMID 11959924. 
  6. ^ "Success of introduced Argentine ants tied to reduced genetic variation". University of California, San Diego. 
  7. ^ http://link.springer.com/article/10.1007%2Fs10886-005-3547-7
  8. ^ http://link.springer.com/article/10.1007%2Fs00040-007-0942-9
  9. ^ L. Passera, L. Keller & J. P. Suzzoni (March 1988). "Control of brood male production in the Argentine ant Iridomyrmex humilis (Mayr)". Insectes Sociaux 35 (1): 19–33. doi:10.1007/BF02224135. 
  10. ^ Markin, George P. (1969). "The Seasonal Life Cycle of the Argentine Ant In Southern California". Annals of the Entomological Society of America 63 (5): 1238. 
  11. ^ a b (http://link.springer.com/article/10.1007/s10530-005-6411-3
  12. ^ "Super ant colony hits Australia". BBC News. 14 August 2004. 
  13. ^ "Proliferation of Argentine ants in California linked to decline in coastal horned lizards". Science Daily. March 5, 2002. 
  14. ^ C. M. Bristow (1991). "Are ant–aphid associations a tritrophic interaction? Oleander aphids and Argentine ants". Oecologia 87 (4): 514–521. doi:10.1007/BF00320414. JSTOR 4219728. 
  15. ^ Crystal D. Grover, Kathleen C. Dayton, Sean B. Menke & David A. Holway (2008). "Effects of aphids on foliar foraging by Argentine ants and the resulting effects on other arthropods" (PDF). Ecological Entomology 33 (1): 101–106. doi:10.1111/j.1365-2311.2007.00942.x. 
  16. ^ Ants - Kill Ants
  17. ^ Ants' own chemical may control them
  18. ^ Rivenburg, Roy (September 15, 2006). "UCI makes ants go ape by giving them B.O.". Los Angeles Times. 
  19. ^ B2 US patent 8,278,360 B2, Sadahiro Tatsuki; Mamoru Terayama & Yasutoshi Tanaka et al., "Behavior-disrupting agent and behavior-disrupting method of Argentine ant", published 2012-10-02, assigned to Shin-Etsu Chemical Co Ltd 
  20. ^ David M Suckling, R. W. Peck, L. M. Manning, L. D. Stringer, J. Cappadonna & A. M. El-Sayed (2008). "Disruption of Foraging by a Dominant Invasive Species to Decrease Its Competitive Ability". Journal of Chemical Ecology 34 (12): 1602–9. doi:10.1007/s10886-008-9566-4. PMID 19034574. 
  21. ^ Fabian L. Westermann, David M. Suckling & Philip J. Lester (2014). "Disruption of Foraging by a Dominant Invasive Species to Decrease Its Competitive Ability" (PDF). PLoS One 9 (3): e90173. doi:10.1371/journal.pone.0090173. PMID 24594633. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly Iridomyrmex humilis.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!