Articles on this page are available in 1 other language: French (1) (learn more)

Overview

Comprehensive Description

Dorylus (Anomma) kohli Wasmann HNS

Twenty workers from Akenge and Niangara, taken from the stomachs of toads (Bufo funereus) and frogs (Kassina senegalensis and Hemisus marmoratum), and a fine series of workers of all sizes from Avakubi (Lang and Chapin) with the following note: "They usually appear in great masses, coming right out of the ground, underneath a piece of meat. Even palm oil, poured on the floor, will attract them in the same way." This observation shows that the species is hypogaeic like the species of Dorylus HNS , sensu stricto, and not epigaeic like Dorylus (Anomma) nigricans HNS and its various subspecies and varieties, and agrees with the observations 'of Father Kohl, quoted by Wasmann: "This species seems to be intermediate between the subterranean Dorylus HNS , sensu stricto, and the driver ants. Its discoverer, Father Kohl, who found it at St. Gabriel near Stanleyville on the Upper Congo, writes as follows: 'The ants just mentioned seem always to wander about beneath the surface of the ground; at any rate, I have seen them on the surface only on three occasions and always after a rain." Wasmann adds the interesting statement: "The subterranean mode of life of D. kohli HNS may also be inferred from its guests, which are much less like those of Anomma HNS than of Dorylus helvolus HNS L. The development of the eyes of Pygostenus pusillus Wasm., which lives with D. kohli HNS , is about half way between the small eyes of P. raffrayi Wasm., a guest of D. helvolus L. HNS , and the very large eyes of the Pygostenus species which live with Anomma wilwerthi Emery HNS . Here, too, there is a hint in regard to the habits of the host." The remarkable wingless phorid Hexacantherophora cohabitans, recently described by H. Schmitz,1 was also found with Dorylus kohli HNS by Father Kohl at St. Gabriel near Stanleyville.

■ 1914, Zool. Jahrb. Abt. Syst., XXXVII, pp. 512-515, Pl. xxix, fig. 1.

  • Wheeler, W. M. (1922): The ants collected by the American Museum Congo Expedition. Bulletin of the American Museum of Natural History 45, 39-269: 44-44, URL:http://plazi.org:8080/dspace/handle/10199/17097
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorylus kohli Wasmann HNS 1904

Dorylus (Anomma) kohli Wasmann HNS 1904: 669. Six syntype workers, DR Congo: St. Gabriel (near Kisangani), collected by P. Kohl, NHME (examined).

Dorylus gerstaeckeri st. quadratus Santschi HNS 1914: 430. Holotype worker, Tanzania: Manow, collected by M. Viehmeyer, NHMB (examined), new synonomy.

Dorylus gerstaeckeri st. quadratus HNS ; Wheeler 1922: 736, Bolton 1995: 180.

Since the diagnostic features of large D. gribodoi HNS workers are constant in all examined samples (from eastern Guinea to eastern Nigeria) and the Dorylus gerstaeckeri st. quadratus HNS worker from Tanzania (more than 3000 km outside the recorded range of D. gribodoi HNS ) lacks these features, we exclude this form from D. gribodoi HNS and place it under D. kohli Wasmann HNS .

FIGURE 13. Dorsal view of the hypopygium of the D. gribodoi HNS queen (HAD 2.53 mm).

FIGURE 14. Dorsal view of D. gribodoi HNS queen mesosoma (PeW 4.54 mm).

The matching of males and workers by analysis of gene sequences of specimens from the same population is a promising approach for clarifying the taxonomy of army ants and other groups of ants in which these forms are rarely collected together. The discovery of more male-worker associations is essential not only for sorting out the taxonomic confusion in Dorylus HNS , but also for determining the diagnostic features of the subgenera.

  • Schöning, C., Gotwald, W. H., Kronauer, D. J. C. (2008): Taxonomy of the African army ant Dorylus gribodoi Emery, 1892 (Hymenoptera, Formicidae) & # 8212; new insights from DNA sequence data and morphology. Zootaxa 1749, 39-52: 49-50, URL:http://hol.osu.edu/reference-full.html?id=21588
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Taxonomic History

7 subspecies

Dorylus (Anomma) kohli Wasmann, 1904b PDF: 669 (s.w.) DEMOCRATIC REPUBLIC OF CONGO. AntCat AntWiki

Taxonomic history

Santschi, 1921c PDF: 114 (s.); Boven, 1968: 732 (q.).
Senior synonym of Dorylus quadratus: Schöning, et al. 2008: 449.
See also: Raignier & Boven, 1955: 78.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Santschi, F., 1912:
  - Grace a l'obligeance du R. P. Wasmann qui me les a communiques, j'ai pu comparer la var. Congolensis avec le type de l'espece dont on ne connait pas encore le [[ soldier ]]. Les [[ worker ]] de 7 mill. de Congolensis different du type par une tete un peu plus courte et des angles posterieurs plus rentres. Quant a la sculpture et a la couleur, elle est a peu pres identique. Du reste, j'ai recu de la meme localite (Brazzaville, Weiss), mais dans d'autres tubes, des [[ worker ]] de kohli i. sp.
 malheureusement non series, jusqu'au soldat comme c'etait le cas pour Congolensis, de sorte qu'il est encore impossible de distinguer les deux formes chez les [[ soldier ]]. - Quant a la var. minor Sants, du Benguela, elle est bien distincte et meritera peut-etre d'etre elevee au rang de race quand on en connaitra les sexues.
 

Santschi, F., 1923:
 o. Long: 2,7 a 12 mm.
  [[ soldier ]]. (11 a 12 mm). Tete noiratre ou rouge sombre, l'occiput toujours plus fonce; joues et thorax d'un rougeatre plus clair, le dessus du promesonotum plus brunatre. Pattes et abdomen brun jaunatre plus ou moins dilue. Tete submate, sauf un large espace au vertex s'eten-dant aux angles posterieurs et sur une bande frontale lisse et luisante. Thorax submat, le dessus moins sculpte, petiole mat. Reste de l'abdomen et appendices luisants, sculpture comme chez congolensis plus fine que chez kohli , les points epars plus effaces; pilosite comme chez congolensis . Tete rectangulaire, plus longue que large (3,5 a 3 mm). plus etroite que chez congolensis et meme que chez emeryi , les cotes paralleles dans ses 3 / 4 anterieurs, le quart restant un peu moins rentrant que chez congolensis , pour former un lobe moins arrondi que chez congolensis , mais bien moins conique que chez emeryi , La tete est en outre moins convexe du front au vertex que chez congolensis . Mandibules plus etroites, plus arquees et plus longues que chez cette derniere forme. Thorax plus etroit (1,4 mm. au milieu de 1,6 mm au pronotum). Petiole aussi long que large derriere ou il est moins elargi que chez congolensis , le gastre aussi plus etroit.
 " [[ worker ]], (10 a 11 mm.). Legerement plus etroite, mandibules un peu plus courtes et epaisses. Parties luisantes de la tete plus reduites que chez le [[ soldier ]].
 ' [[ worker ]]. (9 a 9,5 mm.). Comme la " [[ worker ]] mais la tete moins allongee, plus faiblement echancree derriere.
  [[ worker ]]. (7 a 8 mm.). La tete est plus petite, moins retrecie et echancree derriere que chez congolensis de meme taille. Legerement plus mate, Petiole un peu plus court. L'intervalle entre la dent basale et la terminale devient finement denticule, la dent preapicale commence a apparaitre comme un denticule plus distinct.
  [[ worker ]] '. (5 mm.). Tete plus ou moins roux brunatre, les mandibules brunatres, le reste roussatre. Toutes les dents sont presque aussi developpees que chez emeryi , de meme taille mais plus etroites et lisses.
  [[ worker ]] ". Ne differe de congolensis que par sa couleur un peu plus terne, la tete aussi roussatre que le reste et plus large que chez emeryi .
  Congo belge: Yambata et Avakubi (De Giorgi) (Mus. Tervueren). Se place a cote de congolensis par sa grande taille, D. (A) kohli et ses autres varietes ne depassant guere 8 a 9 mm. (1).
 Kasensero (Dr. Bequaert, 17 - VII- 1914) (Mus. Tervueren). Le plus grand exemplaire de cette serie atteint 10 m. Du reste pareil au type.
 

Wheeler, W. M., 1922:
  Two series of workers, one taken at Leopoldville by Mr. Lang, the other at Thysville by Dr. Bequaert, evidently belong to this variety, in which the head of workers measuring 7 mm. is as broad as long, whereas in the typical kohli it is longer than broad in individuals of the same size, with somewhat less pointed posterior angles.
 The Leopoldville specimens were found "under a piece of tin on the shore of Stanley Pool," those from Thysville were "marching in a subterranean burrow in a forest gallery."
  A series of more than a hundred workers from Malela (Lang and Chapin), taken beneath the prostrate trunk of a palm, represent anew variety near variety frenisyi Forel and variety minor Santschi . They range in size from 3 to 8 mm. The largest are very probably the true maxima workers as they lack the preapical mandibular tooth. In frenisyi the largest workers attain a length of 8.5 mm., in minor 8 mm.
  The head of langi is nearly as broad as long, its sides convex and distinctly converging behind so that the occipital border, which is deeply and rather angularly excised, is about three-fourths as long as the anterior. The dorsal and ventral surfaces of the head are somewhat flattened. The whole body is finely, sharply, and rather uniformly shagreened or minutely and densely punctate and subopaque; the mandibles smooth and shining; the gaster behind its first segment feebly shining. The upper surface of the head, thorax, and gaster are uniformly but sparsely punctate, the punctures nonpiligerous for the most part. The suberect, yellow hairs are very sparse and confined to the gaster and the same is true of the dilute appressed pubescence. Legs and scapes with short stiff and appiessed hairs, absent or very sparse on the extensor surfaces of the femora and tibiae. In some specimens a few very fine short hairs can be detected, under a magnification of 20 diameters, arising from the coarse punctures on the vertex or posterior corners of the head. Color rather bright reddish ferruginous, with the legs paler and the mandibles and the upper surface of the head, except the cheeks and occiput, dark brown or blackish. The upper surface of the thorax and gaster, except the posterior borders of the segments of the latter, are darker and more brownish than the pleurae and venter. The petiole is scarcely longer than broad, its ventral tooth small, compressed and directed backward. The smaller workers have the head of nearly the same shape and proportions as the larger but less deeply excised behind and more shining, as is also the body. The pubescence is also a little more abundant. The color is very similar but paler in the smallest individuals.
 This is a very distinct form, represented by a series of two dozen workers from Stanleyville (Lang and Chapin), without further data. They measure 1.5 to 6 mm. in length. The largest specimens are probably not the maxima forms as they have a preapical mandibular tooth.
 The body is only slightly shining and very similar in sculpture to the preceding variety except that the punctures are coarser, sharper and piligerous. They are evenly distributed over the dorsal surface of the head and pronotum, similar but smaller and shallower on the epinotum and gaster, and very indistinct or absent on the petiole. Mandibles and legs smooth and shining. The head, pro- and mesonotum, gaster, scapes, and legs are covered with short, subappressed, yellow hairs arising from the punctures and forming a conspicuous, rather abundant, coarse pubescence. The body is brownish ferruginous, the head slightly darker, and appendages paler, the mandibles blackish. The head is scarcely longer than broad in front, the sides very feebly convex and converging to the posterior border, which is only slightly excised and about four-fifths as long as the anterior border. The petiole is as broad as long. The smaller workers closely resemble the larger, except that the head is a little longer and the color paler.
 

Santschi, F., 1921:
  - [[ soldier ]] (non decrit). Long. IO mill. Tete large de 2 5 mill., longue de 2.7 mill. Couleur comme chez la var. concolensis Sants, mais la sculpture est un peu plus mate. La forme de la tete " est comme chez la var. minor Sants, mais moins mate, moins fortement ponctuee et plus claire. Le pe-tiole est aussi large, ou plutot legerement plus large derriere que long.
 ' Congo belge: Stanleyville, station St-Gabriel (Kohl), recu de M. Wasmann. (Meme station queles exemplaires types de Wasmann).
  [[ worker ]]. Long. 8 mill. Differe du type par sa couleur generalement d'un roux brunatre clair. Les joues, le petiole et le postpetiole ainsi que les appendices plus jaunatres. Bien plus luisant que D. Kohli, mais moins que chez D. gerstackeri . La tete est plus courte que chez kohli et plus longue que chez gerstackeri Em. Le petiole est aussi long que large, ses cotes encore plus paralleles que chez kohli . Lac Victoria: Biloba (J. Carl.), recu de MV Forel.
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

- [[ soldier ]] (non decrit). Long. IO mill. Tete large de 2 5 mill., longue de 2.7 mill. Couleur comme chez la var. concolensis Sants, mais la sculpture est un peu plus mate. La forme de la tete " est comme chez la var. minor Sants, mais moins mate, moins fortement ponctuee et plus claire. Le pe-tiole est aussi large, ou plutot legerement plus large derriere que long.

 

' Congo belge: Stanleyville, station St-Gabriel (Kohl), recu de M. Wasmann. (Meme station queles exemplaires types de Wasmann).

License not applicable

Santschi, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dorylus kohli

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTGCTCTATGATCAGGAATTTTAGGATCATCAATAAGAATGATTATTCGTTTAGAATTAGGTACATGTGGGACAATAATTTTTAAT---GATCAAGTTTTTAATGCTATTGTTACTAGTCATGCATTTATTATAATTTTTTTTATAGTTATGCCATTTATAATTGGAGGATTCGGAAATTTTATTGCTCCTTTAATAATTGGGGCTCCCGATATAGCTTACCCTCGAATAAATAACATAAGATTTTGATTATTGCCCCCATCTATTACTTTAATAATTATAAGAAATTTTATTAGAGAAGGCCCAGGAACAGGGTGAACTGTTTACCCCCCATTAGCATCAAATATTTATCATAGGGGGGCATCAATTGATTTAACTATTTTCTCATTACATATTGCTGGTATATCCTCCATTTTAGGTGCAATTAATTTTATTTCTACAATTATTAATATACATCATAAAAACTTAACTATAGATAAAACTCCATTATTTGTTTGATCAATTTTAATTACAGCTATCCTCTTACTTCTCTCTTTACCAGTATTAGCAGGGGCAATTACTATATTATTAACTGACCGAAACGTTAATACTTCATTTTTTGATCCCTCTGGAGGAGGGGACCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dorylus kohli

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!