Overview

Comprehensive Description

General Description

Shell morphology: The shell is small, with a length no greater than 60 mm. The shell is modioliform, thick and sturdy, and is essentially equivalve. The anterior margin is sharply rounded, whilst the posterior margin is broadly rounded, becoming angular dorsally. The ventral margin is straight, although can be very slightly concave in the region of the byssal gape in the largest specimens. The dorsal shell margin is very broadly convex. The shell length is greater than twice the height. The umbones are often eroded, and are prosogyrate and subterminal, positioned within the anterior one-twentieth. The prodissoconch II is red, 460 um in length. A raised, broadly rounded ridge extends from the umbonal ridge to the posterior ventral margin.

The shell lacks external sculpture and has a smooth surface except for concentric growth lines and very fine radial periostracal corrugations in the median ventral area. The shell is dull-white in colour beneath a dark-brown to straw-yellow periostracum. The antero-dorsal portion of the periostracum and shell is variably eroded depending on age and collection site. The interior is polished, off-white in colour and predominately nacreous.

The ligament is opisthodetic, parivincular and extends posteriorly from the umbones to occupy 37-50% of the dorsal margin. The adult hinge is edentulous and is thickened below and anterior to the umbo. The juvenile hinge has denticles immediately posterior of the ligament and immediately below the umbones. Hinge denticles are obsolete in specimens greater than 17 mm in length.

Muscle scars: The anterior adductor scar is oblong, and positioned at an oblique angle near to the antero-ventral margin, below the umbo. The posterior adductor scar is round and is contiguous with a small siphonal retractor scar ventrally and the posterior portion of the posterior byssal-pedal retractor scar dorsally. The anterior retractor scar is located within the upper extremity of the umbonal cavity directly beneath the umbo. The posterior byssal retractors form two scars with a moderate gap between them. The anterior of the two scars is obliquely elliptical, and is directly beneath the posterior end of the ligament, whilst the posterior scar is elliptical and parallel to the antero-posterior axis of the shell, and is located antero-dorsally to and bordering the posterior adductor scar. The ventral pallial line is prominent, extending from the median posterior aspect of the anterior adductor scar to the posterior adductor, curving slightly upwards and then downwards to form an indentation in the byssal gape region at about the mid-point of the antero-posterior axis. A small siphonal retractor scar is located at the posterior end of the ventral pallial line and is contiguous with the posterior adductor.

Musculature: The posterior byssal retractors are separated into posterior and anterior portions, each consisting of two main muscle bundles that attach separately to the shell. The posterior portion inserts along the postero-dorsal edge of the posterior adductor, whilst the anterior portion inserts just below and posterior to the posterior end of the ligament. The pedal retractors are very slender, and arise from the antero-dorsal portion of the foot, passing lateral to the anterior retractors and insert lateral to the posterior portion of the posterior byssal retractors. The siphonal retractors are indistinct. They originate in the inner mantle margin around the excurrent siphon, and attach along the postero-ventral edge of the posterior adductor. The anterior retractors arise from the dorso-lateral portion of the foot mass and pass anteriorly to insert in the antero-dorsal extremity of the umbonal cavity. The labial palp suspensors are not evident. The posterior and anterior adductor is rounded.

Foot and byssus: The foot is long and thick. The shape in preserved specimens is variable depending on the degree of contraction. Byssal strands are few to profuse, gray to light-brown in colour, and are thin, flat and unornamented. The byssal gland extends down the foot behind the byssal groove, and is without an extension dorsal to the origin of the anterior retractors.

Mantle and mantle cavity: The connections between the edge of the ascending lamellae and the surface of the mantle lobes and visceral mass are weak or lacking, resulting in an incomplete separation of the incurrent and excurrent chambers. The muscular longitudinal ridges for the attachment of the ascending lamellae to the mantle lobes and visceral mass are lacking. The ventral edges of the inner mantle lobes are not thickened and muscular. The excurrent siphonal opening is a small, tubuliform siphon that is capable of moderate extension beyond the perimeter of the shell, but lacking an internal diaphragm. The fusion of the inner mantle immediately below the excurrent siphon forms a short, incomplete horizontal branchial septum between the incurrent and excurrent chambers. The incurrent and excurrent chambers are not completely separated posterior of the posterior adductor. The posterior ends of the gill axes attach to the underside of the horizontal branchial septum. A short valvular siphonal membrane joins the left and right lobes, and extends anteriorly a short distance into the pedal gape. The anterior edge of the valvular siphonal membrane is smooth, lacking central papilla. The pedo-byssal gape is extensive, with the incurrent aperture extending from the anterior end of the valvular siphonal membrane to the posterior edge of the anterior adductor.

Ctenidia: The lamellae are of unequal height, with the ascending lamellae two-thirds of the height of the descending, resulting in the inner and outer demibranchs forming a short-armed W-shaped gill when viewed in cross-section. The demibranchs are unequal in length, with the inner demibranch slightly longer anteriorly than the outer. The demibranchs are hypertrophied, thick and short. The ventral edges have well-developed recessed food grooves. The dorsal food grooves are present in deep folds just below the junction of the ascending lamellae and the areas of attachment to the mantle lobes and the visceral mass. The filaments are broad and moderately fleshy. The ctenidia and filaments are white in colour. Distal intermellar junctions are lacking. The lamellae are joined apically to ca. one-half the height of the descending and three-quarter height of the ascending lamellae. 'Principal filaments' and 'tubular connections' are lacking.

Labial palps: The paired labial palps are short, broad, flat and triangular. The inner surfaces are plicate, whilst the outer surfaces are smooth. The bases of the inner and outer pair are coincident. Both pairs are in a normal anterior position, without proboscid-like extensions. The outer pair of palps is larger, up to twice the size of the inner pair. The mouth is situated normally at the basal junction of the inner and outer palps. The extreme anterior portions of the gill that are placed between the inner and outer palps are coincident with the plicate palp surfaces.

Digestive system: The alimentary system is well developed for the group. The stomach and direct intestine are located on the body mid-line. The intestine leaves the posterior end of the stomach and passes posteriorly down the midline ventral to the ventricle. A short recurrent loop to the right begins immediately below the posterior end of the ventricle. The recurrent intestine passes anteriorly on the right side. The rectum turns to the mid-line and enters the extreme antero-ventral portion of the ventricle anterior to the auricular openings.

(Gustafson et al., 1998)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Hydrocarbon seeps at Bush Hill in Green Canyon and from a site within Garden Banks petroleum lease block 386 on the Lousiana Continental Slope in the northern Gulf of Mexico in depths from 546-650 m (Gustafson et al., 1998).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Paratype for Tamu fisheri Gustafson et al., 1998
Catalog Number: USNM 880274
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Year Collected: 1991
Locality: Louisiana Continental Slope, Bush Hill Hydrocarbon Seep, Approx. 210 Km SW Of Grande Isle, Louisiana, United States, Gulf of Mexico, North Atlantic Ocean
Depth (m): 548 to 548
Vessel: Johnson Sea Link I DSR/V
  • Paratype: Gustafson, R. G., et al. 1998. Malacologia. 40 (1-2): 63-112, figs. 11-13, 21-23.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Tamu fisheri Gustafson et al., 1998
Catalog Number: USNM 880273
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Year Collected: 1991
Locality: Louisiana Continental Slope, Bush Hill Hydrocarbon Seep, Approx. 210 Km SW Of Grande Isle, Louisiana, United States, Gulf of Mexico, North Atlantic Ocean
Depth (m): 548 to 548
Vessel: Johnson Sea Link I DSR/V
  • Paratype: Gustafson, R. G., et al. 1998. Malacologia. 40 (1-2): 63-112, figs. 11-13, 21-23.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 548 - 548
  Temperature range (°C): 8.336 - 8.336
  Nitrate (umol/L): 29.021 - 29.021
  Salinity (PPS): 34.984 - 34.984
  Oxygen (ml/l): 2.846 - 2.846
  Phosphate (umol/l): 1.891 - 1.891
  Silicate (umol/l): 16.797 - 16.797
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tamu fisheri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTGGCTCGACCAGGAAGCTTTTTGGGAGAT---GACCAGCTTTATAATGTTATTGTAACTGCCCACGCTTTAGTCATAATTTTTTTTATGGTAATGCCTCTGATGGTGGGGGGTTTTGGAAATTGGTTGCTTCCCTTAATAATAGGGTCTATTGATATAATTTTTCCTCGTTTAAACAATCTGAGGTTTTGGTTTTTGCCAGCGTCTCTCTTTGCTTTGTTGCTATCTACATTCATTGAGAGCGGTGCAGGGACTGGGTGGACTTTATACCCACCCTTGTCCTCTTATACTGGACATAGGGGCCCTGCTGTTGACATATCTCTGTTTTCCTTGCATCTGGCGGGTGCGTCTTCTATTGGAGGGTCCATTAATTTCCTGACTAGTATAAAGAATATGTCTGTTGAAAGTATGCGGGGAGAGCGAATAGTCTTATTTGTTTGGTCTATGGCTGTAACAGCAGTTTTATTATTGGTTTCCTTGCCTGTATTAGCAGGGGGAATTACGATGTTGATTTTTGACCGTCATTTTAATACT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tamu fisheri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!