Overview

Comprehensive Description

General Description

Shell morphology: The shell is large, up to 120 mm long, modioliform, thin and fragile. Essentially equivalve, the shell is elliptical in immature specimens, becoming increasingly arcuate in the larger, older specimens. The anterior margin is narrowly rounded, whilst the posterior margin is broadly rounded. The ventral margin is straight to slightly concave in small specimens, and becomes increasingly concave in larger specimens. The dorsal margin is convex. The umbones are often eroded, prosogyrate and nearly terminal to slightly subterminal. The prodissoconch I from 100 - 110 um in length. Prodissoconch II is reddish, between 385 - 404 um in length. An indistinct, raised, broadly rounded ridge or keel extends from the umbonal region to the postero-ventral margin. The external surface lacks any sculpture and is smooth except for concentric growth lines and fine radial periostracal corrugations in the median ventral area. The shell is dull-white in colour, beneath a dark-brown to straw-yellow periostracum. The antero-dorsal portion of the shell can be variably eroded depending on the age and collection site. The interior of the shell is off-white in colour, predominately nacreous. The ligament is opisthodetic, parivincular and extends posteriorly from the umbones to occupy 38 - 58% of the dorsal margin. The adult hinge is edentulous, thickened below and anterior to the umbo. Juvenile hinge has 8 - 9 denticles immediately posterior to the ligament and with 4 - 5 denticles located immediately below the umbones. The hinge denticles are obsolete in specimens greater than 11 mm in length.

Muscle scars: The muscle scars and pallial line are indistinct. The anterior adductor scar is oblong, below and posterior to the umbo. The posterior adductor scar is round, and contiguous dorsally with a single posterior byssal-pedal retractor scar. The anterior retractor scar is located in the posterior portion of the umbonal cavity. The posterior byssal retractors form a continuous scar that extends from directly beneath the posterior end of the ligament to the antero-dorsal edge of the posterior adductor scar. The ventral pallial line is straight and well inset, paralleling the ventral shell margin and extends from the postero-ventral edge of the anterior adductor scar to the posterior adductor.

Musculature: Although the posterior byssal retractors form one continuous scar in each valve, the posterior byssal retractors are subdivided into six main muscle bundles. The posterior pedal retractors are small, thin and arise from the antero-dorsal portion of the foot mass and pass lateral to the anterior bundle of posterior byssal retractors. Siphonal retractors are not evident. The anterior retractors arise just ventral to the origin of the anterior portion of the posterior byssal retractors on the dorsal surface of the byssal-pedal mass, and pass anteriorly to insert in the posterior portion of the umbonal cavity. The paired labial palp suspensors are slender and extend forward as branches of the anterior retractors to attach just behind and adjacent to the anterior adductor. The posterior adductor is oblong, whilst the posterior adductor is small and round in cross-section.

Foot & byssus: The foot is thick, with a shape that varies in preserved specimens depending on the degree of contraction. The byssal strands and light to dark-brown in colour, and are wide, flat and unornamented. The byssal gland extends down the foot behind the byssal groove.

Mantle & mantle cavity: The connections between the edge of the ascending lamellae and the surface of the mantle lobes and the visceral mass are weak or lacking, resulting in an incomplete separation of the incurrent and excurrent chambers. The muscular longitudinal ridges for the attachment of the ascending lamellae to the mantel lobes and visceral mass are lacking. The ventral edges of the inner mantle lobes are thickened and muscular. In live specimens the excurrent tubuliform siphon is capable of moderate extension beyond the edge of the shell. The horizontal branchial septum between the incurrent and excurrent chambers is lacking. The incurrent and excurrent chambers are not physically separated posterior to the posterior adductor. The posterior end of the gill axes attach to the inner wall of the fused inner mantle lobes just ventral to the excurrent siphon. A short valvular siphonal membrane joins the right and left lobes, and extends anteriorly a short distance into the pedal gape. The anterior edge of the valvular siphonal membrane is smooth, and lacking central papilla. The pedo-byssal gape is extensive. The incurrent aperture extends from the anterior end of the valvular siphonal membrane to the posterior edge of the anterior adductor.

Ctenidia: The demibranchs are ca. equal-sized, tall and fleshy. The ventral margins have well-developed food groves. The dorsal food grooves are in deep folds just below the junction between the lamellae and both the mantle lobes and the visceral mass. The ctenidia is off-white in colour. The filaments are thin for Bathymodiolus, but broader than is typical of mytilids. Distal interlamellar junctions are lacking. The descending and ascending portion of each filament is connected apically to one-quarter the height of the demibranch. Every second to sixth filament is a 'principal filament' exhibiting short interlamellar septum that extends dorsally to a slight degree. 'Tubular connections' between the free edges of the ascending lamellae and the gill axes are lacking.

Labial palps: The paired labial palps are greatly modified from the typical filter-feeding type, appearing to function as a sorting area for material gathered by the foot rather than the ctenidia. The base of the inner and outer palp pair are widely separated. The inner pair is placed farther posteriorly, and are large and muscular with a long proboscid-like extension of the far posterior/ end. The mouth is situated at the basal mid-point of the anterior end of the inner pair of labial palps, farther posterior than is typical for mytilids. The outer pair of palps is more anterior, triangular, and muscular, but smaller than the inner pair with a shorter proboscid-like extension.

Digestive system: The stomach and direct intestine are situated on the left of the mid-line. The rectum is located on the mid-line posterior to the entry into the ventricle. The intestine leaves the posterior end of the stomach and transverse a short distance posteriorly to the left of the mid-line. The intestine/ rectum has a very short recurrent loop, which turns in a clockwise direction when viewed dorsally, just prior to turning upwards to enter the ventral aspect of the ventricle just posterior to the auricular ostia.

(Gustafson et al., 1998)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Known from the northern Gulf of Mexico on the Louisiana Continentail Slope from 546-737 m and from the western Gulf of Mexico at Alaminos Canyon at 2222 m (Gustafson et al., 1998).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Paratype for Bathymodiolus childressi Gustafson et al., 1998
Catalog Number: USNM 880271
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Locality: Louisiana Continental Slope, In Brine Pool Nr-1, Louisiana, United States, Gulf of Mexico, North Atlantic Ocean
Depth (m): 650 to 650
Vessel: Johnson Sea Link I DSR/V
  • Paratype: Gustafson, R. G., et al. 1998. Malacologia. 40 (1-2): 63-112, figs.11-13, 16-20.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Bathymodiolus childressi Gustafson et al., 1998
Catalog Number: USNM 880272
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Locality: Louisiana Continental Slope, Louisiana, United States, Gulf of Mexico, North Atlantic Ocean
Depth (m): 650 to 650
Vessel: Johnson Sea Link I DSR/V
  • Paratype: Gustafson, R. G., et al. 1998. Malacologia. 40 (1-2): 63-112, figs.11-13, 16-20.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 650 - 2267.5
  Temperature range (°C): 4.250 - 6.299
  Nitrate (umol/L): 24.434 - 30.686
  Salinity (PPS): 34.884 - 34.979
  Oxygen (ml/l): 3.406 - 5.035
  Phosphate (umol/l): 1.485 - 1.981
  Silicate (umol/l): 20.876 - 26.227

Graphical representation

Depth range (m): 650 - 2267.5

Temperature range (°C): 4.250 - 6.299

Nitrate (umol/L): 24.434 - 30.686

Salinity (PPS): 34.884 - 34.979

Oxygen (ml/l): 3.406 - 5.035

Phosphate (umol/l): 1.485 - 1.981

Silicate (umol/l): 20.876 - 26.227
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

B. childressi from both the Louisiana Continental Slope and the Alaminos Canyon contain methantrophic symbionts in their gills. Intracellular bacteria are limited to bacteriocytes within the gill filaments and have internal membranes typical of Type I methanotrophs (Gustafson et al., 1998).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bathymodiolus aff. childressi ROL-2006

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTAGCTCGTCCTGGTAGCTTTTTAGGTGAT---GACCAGCTTTATAATGTTATTGTAACTGCTCATGCATTGGTTATAATTTTTTTTATAGTTATGCCTTTGATGGTAGGCGGTTTCGGAAATTGACTACTTCCTTTAATGATAGGTTCAATTGATATAATTTTTCCTCGTTTAAATAATCTAAGGTTTTGGTTTTTGCCAGCATCTCTTTTTACTCTTTTGTTGTCTACATTTATTGAGAGAGGCGCTGGGACTGGTTGAACCTTGTACCCTCCGTTATCTTCTTACACTGGGCATAGGGGCCCAGCCGTGGACATGTCTTTATTTTCTTTACATTTAGCAGGTGCTTCTTCTATTGGTGGTTCAATTAATTTTTTGACAAGGATGAAGAATATGTCTGTTGAAAGAATGCGAGGGGAGCGGATAGTTTTATTTGTTTGATCCATGGCTGTGACAGCAGTTTTATTATTAGTTTCTTTACCTGTATTAGCAGGAGGAATCACCATGTTGATTTTTGACCGTCACTTCAAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bathymodiolus aff. childressi ROL-2006

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Bathymodiolus childressi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCATAAGGATATTGGTACTTTATATATTCTACTAGGTTTGTGATCGGGAATAATTGGTACAAGTTTGAGGATGCTGATTCGTATTGAGCTAGCTCGTCCTGGTAGCTTTTTAGGTGAT---GACCAGCTTTATAATGTTATTGTAACTGCTCATGCATTGGTTATAATTTTTTTTATAGTTATGCCTTTGATGGTGGGCGGTTTCGGAAATTGGCTACTTCCTTTAATGATAGGTTCAATTGACATAATTTTTCCTCGTTTAAATAATCTAAGGTTTTGGTTTTTGCCAGCATCTCTTTTTACTCTTTTGTTGTCTACATTTATTGAGAGAGGCGCTGGGACTGGTTGAACCTTGTATCCTCCGCTATCTTCTTATACTGGGCACAGTGGCCCAGCTGTGGACATGTCTTTATTTTCTTTACATTTAGCAGGTGCTTCCTCTATT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGTGGT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bathymodiolus childressi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bathymodiolus childressi

Bathymodiolus childressi is a species of deepwater mussel, a marine bivalve mollusk species in the family Mytilidae, the mussels.

Although this species has been known since 1985,[2] it was formally described as a species in 1998.[1]

Contents

Habitat

This species lives in cold seeps in the Gulf of Mexico.[3]

Bathymodiolus childressi is stenothermal species living in temperatures ranging from 6.5 to 7.2°C.[4] However it was able to survive the temperature of 20°C in the laboratory.[4]

Symbiosis

This mussel harbors intracellular methanotrophic bacteria in its gills.[2] The bacteria provide carbon to the mussel.

Interspecific relationships

The snail Bathynerita naticoidea can detect beds of the mussel Bathymodiolus childressi. It is attracted to water that has been altered by this species of mussel,[3] but the nature of the attractant was not discovered yet.[3] This snail also feeds on periphyton of methanotrophic bacteria that grow on the shells of Bathymodiolus childressi,[3] living on the decomposing periostracum of the mussels[3] and on byssal fibres of those mussels.[3]

Etymology

This species was named after James J. Childress, a marine biologist who investigated the physiology of this mussel at the University of California, Santa Barbara.[5]

References

  1. ^ a b Gustafson R. G., Turner R. D., Lutz R. A. & Vrijenhoek R. C. (1998). "A new genus and five new species of mussels (Bivalvia, Mytilidae) from deep-sea sulfide/hydrocarbon seeps in the Gulf of Mexico". Malacologia 40(1-2): 63-112. page 84.
  2. ^ a b Childress J.J., Fisher C.R., Brooks J.M., Kennicutt M.C., II, Bidigare R. & Anderson A. (1986) A methanotrophic marine molluscan symbiosis: mussels fueled by gas. Science, 233, 1306-1308.
  3. ^ a b c d e f Dattagupta S., Martin J., Liao S., Carney R. S. & Fisher C. R. (2007). "Deep-sea hydrocarbon seep gastropod Bathynerita naticoidea responds to cues from the habitat-providing mussel Bathymodiolus childressi". Marine Ecology 28(1): 193-198. doi:10.1111/j.1439-0485.2006.00130.x
  4. ^ a b Berger M. S. & Young C. M. (2006). "Physiological response of the cold-seep mussel Bathymodiolus childressi to acutely elevated temperature". Marine Biology 149(6): 1397-1402. doi:10.1007/s00227-006-0310-8
  5. ^ "Biographical Etymology of Marine Organism Names". http://www.tmbl.gu.se/libdb/taxon/personetymol/petymol.c.html. Retrieved 28 July 2012. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!