Overview

Comprehensive Description

Bysally attached to sulfur blocks immediately around diffuse venting of water. Endemic to vents. Development unknown, most probably with long planktonic larval phase.
  • CAVANAUGH C. M., WIRSEN C.O. & H.W. JANNASCH (1992) Appl. Environ. Microbiol. 58: 3799-3803.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Mid-Atlantic Ridge: TAG, Snake Pit and Logatchev.
  • CAVANAUGH C. M., WIRSEN C.O. & H.W. JANNASCH (1992) Appl. Environ. Microbiol. 58: 3799-3803.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Shell oval-wedge shaped, rather stout, beaks subterminal. Ventral margin straight to very weakly convex. Postero- dorsal margin markedly convex. Ligament plate slightly arched in anterior part, straighter in posterior part. Exterior smooth, with pronounced irregular growth lines. Periostracum dark brown and rather glossy. Anterior byssus retractor scar on anterior part of the umbonal cavity, in front of the beaks. Anterior part of posterior byssus retractor muscle scar under the posterior third of the ligament, near the end. Animal with large gills. Mantle lobes on anterior half of ventral side separate. Valvular siphonal membrane short.
  • CAVANAUGH C. M., WIRSEN C.O. & H.W. JANNASCH (1992) Appl. Environ. Microbiol. 58: 3799-3803.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Shell length up to 141 mm.
  • CAVANAUGH C. M., WIRSEN C.O. & H.W. JANNASCH (1992) Appl. Environ. Microbiol. 58: 3799-3803.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Bathymodiolus puteoserpentis Von Cosel et al., 1994
Catalog Number: USNM 882204
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): J. Karson
Year Collected: 1988
Locality: Mid-Atlantic Ridge, L'Elan (The Moose) Site, Snake Pit Hydrothermal Field, North Atlantic Ocean
Depth (m): 3515 to 3515
Vessel: Nautile DSR/V
  • Paratype: Von Cosel, R., et al. 1994. The Veliger. 37 (4): 387-391.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 3050 - 3650
  Temperature range (°C): 2.523 - 2.889
  Nitrate (umol/L): 21.028 - 22.153
  Salinity (PPS): 34.913 - 34.944
  Oxygen (ml/l): 5.657 - 5.742
  Phosphate (umol/l): 1.396 - 1.496
  Silicate (umol/l): 34.435 - 42.727

Graphical representation

Depth range (m): 3050 - 3650

Temperature range (°C): 2.523 - 2.889

Nitrate (umol/L): 21.028 - 22.153

Salinity (PPS): 34.913 - 34.944

Oxygen (ml/l): 5.657 - 5.742

Phosphate (umol/l): 1.396 - 1.496

Silicate (umol/l): 34.435 - 42.727
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bathymodiolus puteoserpentis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 35 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTATATATTTTATTGGGGCTGTGGTCTGGAATAATTNGAACGAGTTTAAGTTTACTGATCCGTATTGAATTAGCACGTCCTGGAAGGTTTTTGGGGGAT---GACCAGCTTTATAATGTTATTGTGACTGCCCACGCATTAGTTATAATTTTTTTTATAGTTATGCCTTTGATAGTTGGGGGCTTCGGAAATTGGTTGCTGCCTTTGATAATAGGTTCAATCGACATGATTTTCCCTCGTTTAAATAACTTGAGATTTTGGTTTTTGCCTGCATCTTTATTTACCCTTTTGTTGTCAACATTTATTGAGAGTGGGTCCGGAACTGGGTGAACTTTGTATCCTCCTTTGTCTTCTTATACTGGGCATAGTGGCCCAGCAGTTGATATATCATTATTTTCCCTTCATTTAGCAGGTGCTTCTTCTATTGGGGGTTCAATCAATTTTCTTACAAGCATGAAGAATATGTCTGTTGAGAGTATGCGAGGGGAGCGAATGGTTTTATTTGTATGATCTATGGCTGTAACAGCGGTTTTATTATTAGTTTCTTTGCCTGTGCTAGCTGGGGGGATTACTATGTTGATTTTTGACCGTCATTTCAATACATCTTTTTATGACCCTAGGGGTGGAGGAGACCCTGTTTTGTACCAACAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bathymodiolus puteoserpentis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 34
Specimens with Barcodes: 34
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!