Overview
Comprehensive Description
Bysally attached to sulfur blocks immediately around diffuse venting of water. Endemic to vents. Development unknown, most probably with long planktonic larval phase.
- CAVANAUGH C. M., WIRSEN C.O. & H.W. JANNASCH (1992) Appl. Environ. Microbiol. 58: 3799-3803.
Trusted
Distribution
Mid-Atlantic Ridge: TAG, Snake Pit and Logatchev.
- CAVANAUGH C. M., WIRSEN C.O. & H.W. JANNASCH (1992) Appl. Environ. Microbiol. 58: 3799-3803.
Trusted
Physical Description
Morphology
Shell oval-wedge shaped, rather stout, beaks subterminal. Ventral margin straight to very weakly convex. Postero- dorsal margin markedly convex. Ligament plate slightly arched in anterior part, straighter in posterior part. Exterior smooth, with pronounced irregular growth lines. Periostracum dark brown and rather glossy. Anterior byssus retractor scar on anterior part of the umbonal cavity, in front of the beaks. Anterior part of posterior byssus retractor muscle scar under the posterior third of the ligament, near the end. Animal with large gills. Mantle lobes on anterior half of ventral side separate. Valvular siphonal membrane short.
- CAVANAUGH C. M., WIRSEN C.O. & H.W. JANNASCH (1992) Appl. Environ. Microbiol. 58: 3799-3803.
Trusted
Size
Shell length up to 141 mm.
- CAVANAUGH C. M., WIRSEN C.O. & H.W. JANNASCH (1992) Appl. Environ. Microbiol. 58: 3799-3803.
Trusted
Type Information
Paratype for Bathymodiolus puteoserpentis Von Cosel et al., 1994
Catalog Number: USNM 882204
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): J. Karson
Year Collected: 1988
Locality: Mid-Atlantic Ridge, L'Elan (The Moose) Site, Snake Pit Hydrothermal Field, North Atlantic Ocean
Depth (m): 3515 to 3515
Vessel: Nautile DSR/V
Catalog Number: USNM 882204
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): J. Karson
Year Collected: 1988
Locality: Mid-Atlantic Ridge, L'Elan (The Moose) Site, Snake Pit Hydrothermal Field, North Atlantic Ocean
Depth (m): 3515 to 3515
Vessel: Nautile DSR/V
- Paratype: Von Cosel, R., et al. 1994. The Veliger. 37 (4): 387-391.
Trusted
Ecology
Habitat
Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.
Environmental ranges
Depth range (m): 3050 - 3650
Temperature range (°C): 2.523 - 2.889
Nitrate (umol/L): 21.028 - 22.153
Salinity (PPS): 34.913 - 34.944
Oxygen (ml/l): 5.657 - 5.742
Phosphate (umol/l): 1.396 - 1.496
Silicate (umol/l): 34.435 - 42.727
Graphical representation
Depth range (m): 3050 - 3650
Temperature range (°C): 2.523 - 2.889
Nitrate (umol/L): 21.028 - 22.153
Salinity (PPS): 34.913 - 34.944
Oxygen (ml/l): 5.657 - 5.742
Phosphate (umol/l): 1.396 - 1.496
Silicate (umol/l): 34.435 - 42.727
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 6 samples.
Environmental ranges
Depth range (m): 3050 - 3650
Temperature range (°C): 2.523 - 2.889
Nitrate (umol/L): 21.028 - 22.153
Salinity (PPS): 34.913 - 34.944
Oxygen (ml/l): 5.657 - 5.742
Phosphate (umol/l): 1.396 - 1.496
Silicate (umol/l): 34.435 - 42.727
Graphical representation
Depth range (m): 3050 - 3650
Temperature range (°C): 2.523 - 2.889
Nitrate (umol/L): 21.028 - 22.153
Salinity (PPS): 34.913 - 34.944
Oxygen (ml/l): 5.657 - 5.742
Phosphate (umol/l): 1.396 - 1.496
Silicate (umol/l): 34.435 - 42.727
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Bathymodiolus puteoserpentis
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 35 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 35 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
TTATATATTTTATTGGGGCTGTGGTCTGGAATAATTNGAACGAGTTTAAGTTTACTGATCCGTATTGAATTAGCACGTCCTGGAAGGTTTTTGGGGGAT---GACCAGCTTTATAATGTTATTGTGACTGCCCACGCATTAGTTATAATTTTTTTTATAGTTATGCCTTTGATAGTTGGGGGCTTCGGAAATTGGTTGCTGCCTTTGATAATAGGTTCAATCGACATGATTTTCCCTCGTTTAAATAACTTGAGATTTTGGTTTTTGCCTGCATCTTTATTTACCCTTTTGTTGTCAACATTTATTGAGAGTGGGTCCGGAACTGGGTGAACTTTGTATCCTCCTTTGTCTTCTTATACTGGGCATAGTGGCCCAGCAGTTGATATATCATTATTTTCCCTTCATTTAGCAGGTGCTTCTTCTATTGGGGGTTCAATCAATTTTCTTACAAGCATGAAGAATATGTCTGTTGAGAGTATGCGAGGGGAGCGAATGGTTTTATTTGTATGATCTATGGCTGTAACAGCGGTTTTATTATTAGTTTCTTTGCCTGTGCTAGCTGGGGGGATTACTATGTTGATTTTTGACCGTCATTTCAATACATCTTTTTATGACCCTAGGGGTGGAGGAGACCCTGTTTTGTACCAACAC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Bathymodiolus puteoserpentis
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 34
Specimens with Barcodes: 34
Species With Barcodes: 1
Public Records: 34
Specimens with Barcodes: 34
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!

