Overview

Comprehensive Description

In dense clusters byssally attached to hard bottom around the hydrothermal vents at temperatures up to 18°C. Endemic to vents. Development with long planktonic larval phase; protoconch is 0.4 mm long.
  • COSEL R. VON, METIVIER B. & J. HASHIMOTO (1994) Veliger 37(4): 374-392 [375-380].

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

North Fiji and Lau Back-Arc Basins.
  • COSEL R. VON, METIVIER B. & J. HASHIMOTO (1994) Veliger 37(4): 374-392 [375-380].

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Shell oval-wedge shaped, stout, beaks subterminal. Ventral margin straight to more or less concave. Posterodorsal margin slightly convex to almost straight. Ligament plate slightly arched. Exterior smooth, with irregular growth lines. Periostracum dull, dark brown, in umbonal region lighter brown. Anterior retractor scar at the anterior part of the umbonal cavity. Anterior part of posterior byssus retractor muscle scar at 2/3 of the ligament. Animal with large gills. Mantle lobes on anterior half of ventral side separate. Valvular siphonal membrane short, narrow and rather strong.
  • COSEL R. VON, METIVIER B. & J. HASHIMOTO (1994) Veliger 37(4): 374-392 [375-380].

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Shell length up to 143 mm.
  • COSEL R. VON, METIVIER B. & J. HASHIMOTO (1994) Veliger 37(4): 374-392 [375-380].

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Bathymodiolus brevior Von Cosel et al., 1994
Catalog Number: USNM 882202
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): A. Dinet
Year Collected: 1989
Locality: Lau Basin, Hine Hina Hydrothermal Field, Fiji, South Pacific Ocean
Depth (m): 1842 to 1842
Vessel: Nautile DSR/V
  • Paratype: Von Cosel, R., et al. 1994. The Veliger. 37 (4): 375-380.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Bathymodiolus brevior Von Cosel et al., 1994
Catalog Number: USNM 882201
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): P. Crassous
Year Collected: 1989
Locality: Lau Basin, Valilili Vent Field, Valufa Ridge, Fiji, South Pacific Ocean
Depth (m): 1750 to 1750
Vessel: Nautile DSR/V
  • Paratype: Von Cosel, R., et al. 1994. The Veliger. 37 (4): 375-380.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 1600 - 2500
  Temperature range (°C): 2.569 - 2.931
  Nitrate (umol/L): 35.857 - 38.344
  Salinity (PPS): 34.581 - 34.631
  Oxygen (ml/l): 2.750 - 3.503
  Phosphate (umol/l): 2.481 - 2.775
  Silicate (umol/l): 99.065 - 134.466

Graphical representation

Depth range (m): 1600 - 2500

Temperature range (°C): 2.569 - 2.931

Nitrate (umol/L): 35.857 - 38.344

Salinity (PPS): 34.581 - 34.631

Oxygen (ml/l): 2.750 - 3.503

Phosphate (umol/l): 2.481 - 2.775

Silicate (umol/l): 99.065 - 134.466
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bathymodiolus aff. brevior

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTAGCACGGCCTGGAAGGTTTTTGGGAGAT---GATCAGCTTTACAATGTTATTGTGACTGCTCACGCTTTAGTTATGATTTTTTTTATGGTCATACCTTTAATAGTAGGGGGCTTCGGAAACTGGTTGTTGCCTTTAATAATAGGCTCAATTGACATAATTTTTCCGCGTTTAAATAATTTAAGGTTTTGGTTTTTACCTGCATCCTTGTTTACTCTTTTGTTGTCAACATTTATTGAGAGTGGGTCTGGAACAGGGTGAACTTTATACCCGCCTCTGTCTTCTTATACTGGTCATAGAGGTCCAGCAGTTGATATGTCTTTATTTTCTCTTCATTTAGCAGGTGCTTCTTCTATTGGGGGATCAATTAATTTCCTTACCAGCATGAAAAATATGTCTGTTGAAAGAATGCGGGGTGAACGAATAGTTTTATTCGTTTGATCTATGGCTGTCACAGCAGTTTTATTATTAGTTTCTCTGCCTGTGCTAGCTGGAGGAATTACTATGTTGATTTTTGATCGTCATTTTAACACA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bathymodiolus aff. brevior

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Bathymodiolus brevior

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTATATATTTTATTAGGTTTGTGGTCTGGAATAATTGGAACAAGTTTGAGTATGCTTATTCGTATTGAATTAGCACGGCCTGGAAGGTTTTTGGGAGAT---GATCAGCTTTACAATGTTATTGTGACTGCTCACGCTTTAGTTATGATTTTNTTTATGGTCATACCTTTAATAGTAGGGGGCTTCGGAAACTGGTTGTTGCCTTTAATAATAGGCTCAATTGACATAATTNNNCCGCGTTTAAATAATTTGAGGTTTTGGTTTTTACCCGCATCCTTGTTTACTCTCTTGTTGTCAACATTTATTGAGAGTGGGTCTGGAACAGGGTGAACTTTATACCCGCCTTTGTCTTCTTATACTGGTCATAGAGGTCCAGCAGTTGATATGTCTTTATTTTCTCTTCATTTAGCAGGTGCTTCTTCTATTGGGGGATCAATTAATTTTCTTACCAGCATCGNAAATATGTCTGTCGAAAGAATGCGGGGTGAACGAATAGTTTTATTCGTTTGATCTATGGCTGCNACACGAGTTTTATTATTAGTTTCTCTGCCTGTGCTAGCTGGAGGAATTACTATGTTGATTTTTGATCGTCATTTTAATACATCTTTTTATGACCCTAGAGGAGGAGGAGACCCTGTTTTATACCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bathymodiolus brevior

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 3 specimens with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!