Overview

Comprehensive Description

General Description

Diagnosis: A modioliform shell with slightly recurved ventral margins. The periostracum is polished with fine concentric lirae. The ligament is weak, opisthodetic and external. The hinge line has minute vertical striations.

Description: The shell is thin, elongated and modioliform. The anterior and posterior margins are rounded, with the ventral margin slightly incurved. The surface is ornamented by fine concentric lirae and occasional growth-check marks. There are two obscure radial riblets present on the anterior third of the shell. The periostracum is thin, adherent and light yelow to brown in colour with an iridescent sheen. The umbones are prominent with prosogyrous beaks. The ligament is opisthodetic, sunk in a shallow channel. The interior is polished and subnacreous. The hinge margins are slightly thickened with numerous fine vertical striations. The adductor muscle scars are subequal and indistinct. The pallial line is not visible, and there is no pallial sinus.

Anatomy: The mantle is fused only by an inner fold to form a small separate exhalant aperture. The mantle margins are muscularised and strongly attached to the periostracum which forms a band on the inner shell margins. There are no tentacles or papillae present and the marginal folds are reduced, except in the region of the inhalant aperture where an extensible hood is present. The foot is small, laterally compressed with a small planar sole. A deep byssal groove is present. The pedal retractor and extensor muscles are well developed. The gills are rather small and thick. The labial palps are small and narrow. The lips are small and simple. The stomach is small; the crystalline-style pouch and midgut are conjoined. The intestine passes over the adductor muscle and terminates in an extensible rectum.

(Bernard, 1978)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 1519.5 - 2415
  Temperature range (°C): 1.744 - 2.777
  Nitrate (umol/L): 34.711 - 41.842
  Salinity (PPS): 34.493 - 34.634
  Oxygen (ml/l): 1.490 - 3.998
  Phosphate (umol/l): 2.419 - 3.037
  Silicate (umol/l): 68.288 - 176.733

Graphical representation

Depth range (m): 1519.5 - 2415

Temperature range (°C): 1.744 - 2.777

Nitrate (umol/L): 34.711 - 41.842

Salinity (PPS): 34.493 - 34.634

Oxygen (ml/l): 1.490 - 3.998

Phosphate (umol/l): 2.419 - 3.037

Silicate (umol/l): 68.288 - 176.733
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Whale-Fall Communities

 The species associated with this article are major components of the successionary communities arising around bathyal whale carcasses (though by no means the only whale-fall associated species).

A whale carcass arriving on the bathyal sea-floor (roughly 700-1000m depth) represents a massive influx of nutrients to an otherwise nutrient-poor ecosystem (Lundsten et al 2010a; Lundsten et al 2010b; Smith and Baco 2003). The background rate of carbon deposition to the deep-sea floor is on the order of tens of kilograms per hectare per year (Smith and Baco 2003); an adult whale can weigh up to 160 tons. Consequently, it has long been thought that whale carcasses must represent a significant source of nutrients for sea-bed communities. Additionally, since the discovery of deep-sea hydrothermal vents and cold seeps, it has been hypothesized that whale-falls may serve as stepping stones for the dispersal of organisms between chemosynthesis-dominated bottom communities (Smith and Baco 2003). 

The community observed to spring up around whale carcasses has been characterized as having three major successionary stages (Danise et al 2012):

-Mobile scavenger stage: large, mobile detritivores consume the flesh of the whale. 

-Enrichment opportunist stage: slow-moving or sessile organisms colonize the nutrient-enriched area in and around the carcass.

-Sulphophilic stage: a chemosynthesis-dominated system based on the sulfides released by anaerobic decomposition of bone lipids.

The duration of the first stage depends largely on the mass of the whale, ranging from a few months to up to one and a half years. Initially the community is dominated by large detritivores such as sleeper sharks and hagfish, but as the amount of flesh available decreases, smaller scavengers such as rattails, amphipods, and and lithodid crabs begin to replace them. Once the bulk of the tissue is removed from the skeleton, the community begins to shift to phase two. At this point, extremely dense populations of dorvilleid worms and other polychaetes, as well as crustaceans and gastropods colonize the area around the carcass, exploiting the rich organic material in the surrounding sediments. The rapid recruitment of these organisms suggests they may be opportunistic whale-fall specialists. Over time, without a discrete boundary, sulphide emission from anaerobic decay of bone lipids in the whale skeleton begins to support a chemosynthetic fauna similar to that found around cold seeps and hydrothermal vents, including bacteria, organisms with endosymbiotic bacteria, bacterial grazers, and small predators. This community may linger for up to several decades (Smith and Baco 2003). Fossil evidence suggests that a similar pattern of succession has been evolving since the late Miocene, and may even have operated on the carcasses of Cretaceous plesiosaurs (Danise et al 2012). 

As always in ecology, this picture is somewhat oversimplified. In two 2010 articles, Lundsten et al observe that in addition to chemosynthetic fauna and whale-fall specialists, whale carcasses are often characterized by increased density of the background sea-floor organisms, particularly as time passes since the fall of the whale. Lundsten et al and Glover (2010) additionally found that there is a notable depth gradient in community structure, with fully sulphophilic ecosystems only developing on large, deep carcasses.

The function of whale-falls as stepping stones between cold seeps and hydrothermal vents remains unproven, but there is evidence for relatively large numbers of whale-fall specialist species, especially in the enrichment opportunist and sulphophilic stages (Smith and Baco 2003). Nearest-neighbor analyses of whale falls based on whale populations and the probability of a carcass sinking suggest that carcasses are distributed such that most organisms found in the latter two stages could easily disperse larvae between whale-fall sites. Unfortunately, this ecosystem may be endangered by declining whale populations and may even have already lost a great deal of diversity, as 19th century whale-fall density was likely up to six times higher than that in the present day (Smith and Baco 2003). 

  • Danise S, Cavalazzi B, Dominici S, Westall F, Monechi S, Guioli S. 2012. Evidence of microbial activity from a shallow water whale fall (Voghera, northern Italy). Paleogeography, Paleoclimatology, Paleoecology. 317-318: 13-26.
  • Glover AG, Higgs ND, Bagley PM, Carlsson R, Davies AJ, Kemp KM, Last KS, Norling K, Rosenberg R, Wallin KA, Kallstrom B, Dahlgren TG. 2010. A live video observatory reveals temporal processes at a shelf-depth whale-fall. Cahiers de Biologie Marine. 51:375-381.
  • Lundsten L, Paull CK, Schlining KL, McGann M, Ussler III W. 2010. Biological characterization of a whale-fall near Vancouver Island, British Columbia, Canada. Deep-Sea Research I, 57:918-922.
  • Lundsten L, Schlining KL, Frasier K, Johnson SB, Kuhnz LA, Harvey JBJ, Clague G, Vrijenhoek RC. 2010. Deep-Sea Research I, 57:1573-1584.
  • Smith CR and Baco AR. 2003. Ecology of whale falls at the deep-sea floor. Oceanography and Marine Biology: an Annual Review. 41:311-354.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

I. washingtonia demonstrates strong evidence of protandric hermaphroditism. Developing males were recognised in individuals as small as 1.7 mm shell length and spermatogenesis continued until not, vert, similar7 mm length. At >6.5 mm, males were generally spent and the first previtellogenic oocytes were observed. Although developing females were found as small as 4.5 mm shell length, most well-developed females were >6 mm shell length. Overall, females only formed not, vert, similar12% of the population. As with other modiolid bivalves, fecundity was high and the egg size <50 μm, indicative of planktotrophic development. The occurrence of protandric hermaphroditism, high fecundity and planktotrophic dispersal may be an adaptation to the ephemeral nature of their habitat (Tyler et al., 2009).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Idas washingtonia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTGGCTCGCCCCGGGAGGTTCCTGGGAGAT---GACCAGCTTTACAATGTTATTGTTACTGCTCATGCTCTAGTTATAATTTTTTTTATGGTGATGCCGCTAATAGTGGGCGGGTTTGGAAACTGGCTACTTCCTTTAATAATAGGGTCAATTGACATAATTTTCCCTCGTTTAAATAATTTGAGTTTTTGGTTTTTACCTGCCTCGCTTTTCACTTTGTTATTGTCAACCTTTATTGAAAGAGGCTCGGGCACGGGGTGGACGTTGTACCCTCCCTTATCTTCTTACACTGGCCACAGAGGTCCAGCAGTAGATATGTCTCTATTTTCTTTACACTTGGCCGGTGCTTCTTCTATTGGTGGGTCAATTAATTTCTTAACTAGAATGAAAAATATATCTGTTGAGAGGATGCGTGGGGAGCGGATGGTCTTATTTGTCTGATCTATGGCTGTAACAGCAGTGTTACTATTAGTGTCTTTGCCAGTGTTGGCAGGGGGTATCACTATGTTAATTTTTGATCGTCATTTTAACACT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Idas washingtonia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!