Ecology

Habitat

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 4 - 4
  Temperature range (°C): 28.170 - 28.170
  Nitrate (umol/L): 0.394 - 0.394
  Salinity (PPS): 34.120 - 34.120
  Oxygen (ml/l): 4.336 - 4.336
  Phosphate (umol/l): 0.238 - 0.238
  Silicate (umol/l): 2.754 - 2.754
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Modiolus nipponicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTGCTTCCCTTGATAATAGGGTCAGTAGACATGATTTTTCCTCGTCTTAATAATTTAAGGTTTTGGTTTCTTCCCTCTTCTCTCTTTATGTTATTAAGCTCCACTTTTATTGAAAGCGGGTCTGGTACGGGTTGAACTCTCTACCCGCCTCTTTCTTCTTATACTGGTCACAGGGGTCCAGCTGTTGATATGTCTTTGTTTTCTTTACATCTTGCGGGTGCTTCTTCTATTGGGGGTTCTATTAACTTCCTAACTAGAATGAAAAATATGCCGGTAAAACCAATACAAGGGGAGCGGATAATGCTTTTTTTGTGGTCTATGGTGGTTACTGCGGTGCTTCTCTTGGTTTCTTTGCCTGTACTTGCTGGGGGTATCACTATATTAATTTTTGATCGTCATTTTAATACTTCTTTTTACGACCCGATGGGAGGAGGGGACCCTGTTCTATACCAGCATTTGTTTTGGTTTTTTGGACATCCGGAAGTGTATGTTCTTATTTTGCCTGGGTTTGGGATGGTGTCTCATGTCGTTGCTCATTGTGCCGGAAAGGACGAAGTTTTTGGTGTATTAGGGATAATTTATGCAATAGTTTGTATTGGCGTCCTTGGTTTTATTGTGTGAGGTCATCATATGTTTACCGTGGGTATAGATGTTGATTCTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Modiolus nipponicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!