Articles on this page are available in 1 other language: Spanish (8) (learn more)
Physical Description
Type Information
Syntype for Modiola brasiliensis mutabilis Carpenter, 1857
Catalog Number: USNM 715824
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: dry
Locality: Mazatlan, Sinaloa, Mexico, North Pacific Ocean
Catalog Number: USNM 715824
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: dry
Locality: Mazatlan, Sinaloa, Mexico, North Pacific Ocean
- Syntype: Carpenter, P. P. 1857. Catalogue of the Collection of Mazatlan Shells in the British Musuem. 552 pp.
© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Trusted
Ecology
Habitat
Depth range based on 3 specimens in 1 taxon.
Environmental ranges
Depth range (m): 0.025 - 0.025
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Environmental ranges
Depth range (m): 0.025 - 0.025
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Modiolus brasiliensis
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
AAAGATATTGGTACCTTATACATAATTTTTGGTGTATGATGTGGGTTAGTTGGCACAGGCTTGTCACTCTTAATTCGGTTAGAGCTTGGAACAGTGGGA---ACCTTAACTGAT---GATCACTTTTTCAACGTGGTTGTAACTGCGCATGCTTTTGTCATAATTTTTTTTATGGTTATACCAATTATAATTGGCGGATTTGGAAACTGGATGGTCCCAATACTTATTGGTGCTCCTGATATAAGATTTCCACGAATAAATAATATAAGGTTTTGACTTTTACCACCTTCATTTACTTTGTTAATCTGTTCAAGTATAGTGGAAGGAGGGGCTGGAACTGGGTGGACTGTGTACCCGCCCTTAAGTTCTTGCTTAGGACACAGAGGGGCTTCAGTTGATTTAGCTATTTTTTCTTTACATTTGGCTGGTGTATCCTCAATTTTAGGGGCAATCAATTTTATTACGACGGTGTATAATATACGAGCCTCTGGGCTAACTATAGAACGGGTAAGCTTATTCGTGTGGTCAATTTTAGTTACAGTGTTTCTACTATTGTTATCATTGCCAGTTCTAGCGGGGGCAATTACTATACTATTAACGGATCGTAACTTT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Modiolus brasiliensis
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
