Physical Description
Type Information
Holotype for Terua crypta Dall et al., 1938
Catalog Number: USNM 333333
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: dry
Collector(s): United States Fish Commission
Locality: off Oahu, Hawaii, United States, North Pacific Ocean
Microhabitat: in Feredo boring with Cocculina minutissima Dall
Depth (m): 386 to 386
Vessel: Albatross R/V
Catalog Number: USNM 333333
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: dry
Collector(s): United States Fish Commission
Locality: off Oahu, Hawaii, United States, North Pacific Ocean
Microhabitat: in Feredo boring with Cocculina minutissima Dall
Depth (m): 386 to 386
Vessel: Albatross R/V
- Holotype: Bull. Bernice P. Bishop Mus. 153: p. 58, pl. 11, fig. 5-6.
© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Adipicola crypta
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 19 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 19 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
ACTTTATATATTTTATTAGGTTTGTGGTCGGGAATGATTGGGACAAGATTGAGAATACTAATTCGTATTGAATTGGCGCGCCCTGGAAGATTCTTGGGTGATGACCAACTTTATAATGTTATTGTAACTGCTCATGCGCTGGTCATAATTTTTTTTATGGTTATACCTTTGATGGTAGGAGGCTTTGGAAATTGGCTACTTCCTTTAATAATGGGTTCAATTGATATGATTTTCCCTCGTCTGAATAACTTAAGTTTCTGGTTTTTGCCAGCATCTTTATTTACTCTTTTGTTATCTACATTTATTGAAAGGGGTTCTGGGACTGGGTGAACTTTATACCCTCCTTTGTCTTCTTATACTGGGCACAGAGGTCCAGCAGTTGATATGTCTCTATTTTCTTTACACTTGGCAGGTGCTTCCTCTATTGGAGGCGCAATTAATTTTCTTACTAGTATGAAGAATATGTCTGTTGAAAGTATGCGAGGGGAGCGAATAGTTTTATTTGTGTGGTCTATAGCTGTAACAGCAGTGTTGTTGCTAGTTTCTTTGCCGGTGTTAGCAGGAGGTATTACTATGTTG
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Adipicola crypta
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
