Overview

Comprehensive Description

Taxonomic History

1 subspecies

Dorylus orientalis Westwood, 1835 PDF: 72 (m.) INDIA. AntCat AntWiki

Taxonomic history

Forel, 1901a PDF: 463 (w.).
Combination in Dorylus (Alaopone): Emery, 1895l PDF: 731.
Senior synonym of Dorylus curtisii (and its junior synonym Dorylus oberthueri): Forel, 1901a PDF: 463; of Dorylus longicornis: Bingham, 1903 PDF: 4; Wilson, 1964a PDF: 442; of Dorylus fuscus: Wilson, 1964a PDF: 442.
Current subspecies: nominal plus Dorylus orientalis obscuriceps.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

India, Sri Lanka, Myanmar, Vietnam
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dorylus orientalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTATAATTGGGGGATTTGGAAATTTTATTGCCCCATTAATAATTGGTGCACCTGATATAGCTTATCCACGAATAAATAATATAAGATTTTGATTATTACCTCCATCTATTACTTTAATAATTAGAAGAAACTTTATTAATACAGGCCCAGGAACAGGATGAACAGTTTACCCACCTTTAGCTTCTAGTATTTATCATAGAGGGGCATCAATTGATTTAACTATTTTTTCACTTCATATTGCAGGTATATCATCAATTTTAGGTGCTATTAATTTTATTTCAACAATTATTAACATACATCATAAAAATTTAACTATAGATAAAACACCTTTATTTGTTTGATCAATTTTAATTACAGCTATTTTATTACTATTATCTTTACCAGTATTAGCTGGTGCAATTACTATATTATTAACTGATCGAAATATTAATACTTCATTTTTTGATCCCTCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGACATCCAGAAGTTTATATTCTAATCTTACCAGGATTTGGAATAATTTCTCATATTATTTCAAATGAAAGAGGAAAAAAAGAAACATTTGGATCATTAAGAATAATTTATGCATTAATAGCTATTGGATTCTTAGGATTTATTGTTTGAGCACATCATATATTTACAGTTGGAATAGATGTAGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dorylus orientalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!