Articles on this page are available in 1 other language: French (1) (learn more)

Overview

Comprehensive Description

Taxonomic History

Dorylus (Anomma) mayri Santschi, 1912b PDF: 159, fig. 13 (w.) CAMEROUN. AntCat AntWiki
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Santschi, F., 1912:
 - [[ worker ]] media major. Long. 10 mill. - Brun rougeatre assez fonce. De l'epistome au vertex plus obscur. Antennes et pattes rougeatres, articulations des pattes testacees.
 Devant de la tete, thorax, petiole et postpetiole mats, reste de la tete luisant, gastre assez luisant. Reticule ponctue dans les parties mates, lisse avec quelques points tres epars dans les parties luisantes de la tete. Quelques grands poils jaunes sur le gastre qui est en outre assez pubescent. Pedicule glabre.
  Tete un peu plus longue que large a cotes tres arrondis en arriere vers les angles qui sont tres mousses, rentrant et limitent un bord posterieur etroit et echancre (presque aussi etroit que chez arcens ). Les mandibules portent encore une dent preapicale separee de la dent basale par une serie de denticules. Thorax elance comme chez arcens . Le pedicule est deux fois aussi long que large presque aussi large en arriere qu'en avant avec les angles posterieurs arrondis. Les stigmates un peu saillants mais moins que chez wilverthi Em. et arcens , le dos du pedicule convexe, a peine releve en arriere. Epines inferieures longues, etroites et aigues.
 Long. du scape 1.5 mill., du tibia posterieur 3 mill.
  Une [[ worker ]] media a la tete encore luisante, un peu plus claire et relativement aussi courte que chez la [[ worker ]] major. Une [[ worker ]] de 5.5 mill. est mate, la tete bien plus courte que chez les [[ worker ]] burmeisteri de meme taille avec les angles posterieurs bien moins saillants.
 Kameroun. - 3 [[ worker ]] communiquees par M. le Prof. C. Emery qui les avait recues de Mayr.
  C'est une forme qui parait assez voisine d' arcens , les soldats sont probablement tres grands.
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

- [[ worker ]] media major. Long. 10 mill. - Brun rougeatre assez fonce. De l'epistome au vertex plus obscur. Antennes et pattes rougeatres, articulations des pattes testacees.

 

Devant de la tete, thorax, petiole et postpetiole mats, reste de la tete luisant, gastre assez luisant. Reticule ponctue dans les parties mates, lisse avec quelques points tres epars dans les parties luisantes de la tete. Quelques grands poils jaunes sur le gastre qui est en outre assez pubescent. Pedicule glabre.

 

Tete un peu plus longue que large a cotes tres arrondis en arriere vers les angles qui sont tres mousses, rentrant et limitent un bord posterieur etroit et echancre (presque aussi etroit que chez arcens ). Les mandibules portent encore une dent preapicale separee de la dent basale par une serie de denticules. Thorax elance comme chez arcens . Le pedicule est deux fois aussi long que large presque aussi large en arriere qu'en avant avec les angles posterieurs arrondis. Les stigmates un peu saillants mais moins que chez wilverthi Em. et arcens , le dos du pedicule convexe, a peine releve en arriere. Epines inferieures longues, etroites et aigues.

 

Long. du scape 1.5 mill., du tibia posterieur 3 mill.

 

Une [[ worker ]] media a la tete encore luisante, un peu plus claire et relativement aussi courte que chez la [[ worker ]] major. Une [[ worker ]] de 5.5 mill. est mate, la tete bien plus courte que chez les [[ worker ]] burmeisteri de meme taille avec les angles posterieurs bien moins saillants.

 

Kameroun. - 3 [[ worker ]] communiquees par M. le Prof. C. Emery qui les avait recues de Mayr.

 

C'est une forme qui parait assez voisine d' arcens , les soldats sont probablement tres grands.

License not applicable

Santschi, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dorylus mayri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCTTTATGATCAGGAATCCTAGGATCATCAATAAGAATAATTATTCGTTTAGAATTAGGGACTTGCGGAACAATAATTTTTAAT---GACCAAGTTTTCAATGTTATTGTAACAAGTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCATTTATAATTGGAGGTTTTGGTAACTTTATTGCACCGTTAATAATTGGTGCACCTGACATGGCCTATCCTCGTATAAACAATATAAGATTTTGATTATTACCCCCCTCAATTACTTTAATAATTATAAGGAATTTTATTAACACTGGCTCAGGAACCGGGTGAACTGTATACCCCCCTTTAGCCTCAAATATTTATCATAACGGAGCATCAATTGATTTAACTATTTTTTCATTACATATTGCAGGAATATCATCTATTTTAGGAGCAATTAATTTTATTTCTACAATTATTAATATACATCATAAAAATCTAACTATAGATAAAACACCATTATTTGTTTGATCTATTTTAATTACAGCTATCCTTTTATTACTTTCATTACCAGTTTTAGCAGGGGCCATCACTATATTATTAACCGACCGTAATATTAACACATCATTTTTTGATCCATCAGGAGGAGGAGATCCTATTTTATATCAACANTTATTTTGATTTTTTGGACACCCNGAAGTTTACATTTTAATTTTACCTGGATTTGGTATGATTTCTCATATTATTTCAAATGAAAGAGGAGAAAAAGAAACATTTGGNTCATTAAGAATGATTTACGCTNTTATAGCTATTGGTTTTTTAGGATTTATTGTTTGNGCTCATCATATATTTACAGTAGGTATAGATGTNGATACANGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dorylus mayri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!