Articles on this page are available in 1 other language: French (5) (learn more)

Overview

Comprehensive Description

Taxonomic History

Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Forel, A., 1909:
 — [[ male ]]. — Congo (Deleval);
 Mayumbe (Cabra); Chikai (Cabra); Mukonje Farm, Kamerun (R. Rohde); Zambi (don Lopez).
  Les deux types de Mukonje Farm semblent etre la var. funereus Emery.
 — [[ male ]]. — Sankuru, Kassai, Congo beige (Luja).
 

Santschi, F., 1912:
  - Cette race varie un peu, des exemplaires du Dar Benda ont chez le soldat (12.5 mill.) la tete presque aussi large que longue (largeur 3.5 mill) et les cotes plus convexes que chez ceux du Cameroun. En outre, quoique entierement mate, la tete est moins opaque et le pedicule a les angles posterieurs aussi saillants que chez molesta , ce qui n'est pas le cas chez le type. Les mandibules sont toujours plus larges que chez arcens et burmeisteri avec un bord interne un peu deprime, prismatique, les deux tiers externes sont plus arques que chez arcens mais moins que chez burmeisteri .
  Les [[ worker ]] de 7 mill. ont la tete bien plus allongee que chez burmeisteri et ses varietes de meme taille, elle est en outre relativement plus petite et moins robuste, puis ce n'est qu'en dessous de 5 mill. qu'elle commence a devenir luisante. En outre, le penultieme article du funicule est environ trois fois aussi long qu'epais.
 Dar Benda meridional, Krebedje (Fort Sibut) Mission Charri Tchad (Dr J. Decorse.) Museum de Paris. - Cameroun Molunda (Reichensperger) et types du Cameroun aimablement communiques par M. le Prof. C. Emery.
 

Santschi, F., 1923:
 [[ soldier ]]. Long: 13 mm. (15 avec les mandibules). D'un rouge brunatre, thorax plus violace, avec le dos plus obscur, la tete, moins ses appendices, noir brunatre, le dessus noir. Celle-ci est lisse et luisante sauf son plan anterieur qui, comme le thorax, est submat, densement et finement ponctue; le reste de l'insecte lisse et luisant. Dessus du corps glabre, seuls quelques poils en dessous et au bout du gastre ainsi qu'a l'epistome. La pubescence abonde sur les tarses et les funicules, plus clairsemee sur le reste des pattes, rare ou absente ailleurs.
  Tete robuste, trapezoidale, presque aussi large devant que longue (4,2 - 4,3 mm.); les cotes beaucoup plus convexes que chez arcens Westw. et surtout que chez burmeisteri Shuck. Le bord posterieur relativement etroit (2 mm. d'un angle a l'autre) et plus echancre que chez arcens . Les articles du funicule nettement plus longs que chez burmeisteri . Mandibules comme chez arcens mais plus robustes et plus epaisses, avec la dent basale aussi petite ou meme plus petite. Thorax comme chez arcens . Petiole un peu plus long et plus large derriere, a peu pres comme chez burmeisteri .
  " [[ worker ]], (ii mm. sans les mandibules). Celles-ci different des burmeisteri de meme taille par leur dent basale plus petite et par la presence de denticules le long du bord interne de l'intervalle de cette
 (1) D'apres des exemplaires types recus du R. P. Wassmann et revises par lui-meme.
  dent a l'apicale. Cette partie de la mandibule est du reste plus large et plus deprimee chez terrificus . La tete est plus large que chez burmeisteri . Le petiole plus etroit derriere que chez cette derniere, et moins luisant que chez le [[ soldier ]].
  ' [[ worker ]]. (8 a 9 mm.). Tete plus large et plus convexe lateralement que chez burmeisteri et arcens de meme taille. La dent preapicale developpee comme chez cette derniere, mais l'intervalle dente qui la separe de la basale plus rectiligne, la mandibule etant plus large et deprimee.
  [[ worker ]] '. (5 mm.). Tete plus brusquement et fortement retrecie derriere que chez burmeisteri et arcens ; les cotes plus convexes. La sculpture un peu moins luisante que chez le [[ soldier ]].
  Congo belge: Kasai, Kondue (E. Luja) (Mus Tervueren). Doit se placer a cote de burmeisteri dont elle differe surtout par sa robustesse.
 

Santschi, F., 1930:
 [[ worker ]] et [[ soldier ]] - (non decrits).
  [[ soldier ]]. — Long.: 11 mm. sans les mandibules, 13 mm. avec les mandibules. Noir comme chez D. arcens Westw . mais la tete est aussi large devant que longue, le bord posterieur un peu moins echancre que chez Burmeisteri Shuck, les angles plus mousses, les cotes arques. Profil du mesoepinotum moins convexe et cotes du periole moins divergents en arriere que chez burmeisteri . Tete, moins le quart anterieur, pronotum et gastre, moins le postpetiole, lisses et tres luisants. Le reste submat ou mat. Quelques poils vers l'epistome, le dessus et le dessous du petiole, sous le postpetiole et le gastre ainsi que sur le bord posterieur des ter-gites abdominaux.
  [[ worker ]] (media). — Long.: 6 mm. Tete a peine plus longue que large, distinctement plus courte que chez burmeisteri de meme taille. Couleur et sculpture du [[ soldier ]].
  [[ worker ]] " (minor). — Long.: 2,5 mm Presque aussi foncee que les grandes ouvrieres, elles ont la tete lisse et presque aussi allongee que chez burmeisteri .
 Soudan francais: Bamakou (J. Andrieu), 2 series de toutes tailles.
  Le Dorylus (Anomma) nigricans a ete decrit par Illiger sur le [[ male ]]. Bien que Emery et Mayr aient rapporte a cette forme des [[ soldier ]] et [[ worker ]] de burmeisteri , ces dernieres neutres sont actuellement considerees comme race ou sous-espece de nigricans . Il resulte de cela que D. A. nigricans n'est encore connu que comme [[ male ]]. Je pense donc bien faire de designer une forme neutre [[ soldier ]] et [[ worker ]], au type de l'espece en prenant comme telle la forme ci-dessus decrite.
  Elle ressemble a arcens par sa couleur, mais elle est bien plus luisante, les angles posterieurs de la tete bien moins prolonges. Les mandibules plus courtes. Les articles du funicule moins longs. Le petiole plus large derriere.
 

Bernard, F., 1953:
  Le plus commun et le plus nuisible des Anomma . La nomenclature de ses nombreuses varietes est confuse et meritera une mise au point quand tous les males seront connus. Les captures locales comprennent au moins 3 formes:
 D. nigricans typique, roux-fonce, tete souvent noire. Abondant a N'Zo, 500 m. Quelques ouvrieres de Yanle (st. F 19);
 , noire et plus mate', tete plus convexe: une grosse ouvriere typique de Yalanzou; race purement occidentale;
  , rougeatre et mate, plus repandue, atteignant 2.400 m. au pic de Fernando Poo. LAMOTTE n'en a pris que de petites ouvrieres dans des releves de detail, et n'a pas du la rencontrer en colonne Yanle (commun), Nion, N'Zo (plus rare), Camp I du Mont To (1.600 m.), abondante. On rattache habituellement a cette race la banale var. molesta , que je placerai, d'apres SANTSCHI, avec l'espece suivante:
 

Santschi, F., 1914:
 Mag. Insekten, vol. I, p. 188 (1802), [[male]]. - Emery, apud P. Wytsman, Genera lnsectorum, Formicidae, subfam. Dorylinae, fasc. CII, p. 12 (1910).
 Uganda central: M'Bale (1909), 1 [[male]].
 Distribution geographique. -Afrique occidentale: Congo, surtout dans le bassin du Niger.
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

[[ worker ]] et [[ soldier ]] - (non decrits).

 

[[ soldier ]]. — Long.: 11 mm. sans les mandibules, 13 mm. avec les mandibules. Noir comme chez D. arcens Westw . mais la tete est aussi large devant que longue, le bord posterieur un peu moins echancre que chez Burmeisteri Shuck, les angles plus mousses, les cotes arques. Profil du mesoepinotum moins convexe et cotes du periole moins divergents en arriere que chez burmeisteri . Tete, moins le quart anterieur, pronotum et gastre, moins le postpetiole, lisses et tres luisants. Le reste submat ou mat. Quelques poils vers l'epistome, le dessus et le dessous du petiole, sous le postpetiole et le gastre ainsi que sur le bord posterieur des ter-gites abdominaux.

 

[[ worker ]] (media). — Long.: 6 mm. Tete a peine plus longue que large, distinctement plus courte que chez burmeisteri de meme taille. Couleur et sculpture du [[ soldier ]].

 

[[ worker ]] " (minor). — Long.: 2,5 mm Presque aussi foncee que les grandes ouvrieres, elles ont la tete lisse et presque aussi allongee que chez burmeisteri .

 

Soudan francais: Bamakou (J. Andrieu), 2 series de toutes tailles.

 

Le Dorylus (Anomma) nigricans a ete decrit par Illiger sur le [[ male ]]. Bien que Emery et Mayr aient rapporte a cette forme des [[ soldier ]] et [[ worker ]] de burmeisteri , ces dernieres neutres sont actuellement considerees comme race ou sous-espece de nigricans . Il resulte de cela que D. A. nigricans n'est encore connu que comme [[ male ]]. Je pense donc bien faire de designer une forme neutre [[ soldier ]] et [[ worker ]], au type de l'espece en prenant comme telle la forme ci-dessus decrite.

 

Elle ressemble a arcens par sa couleur, mais elle est bien plus luisante, les angles posterieurs de la tete bien moins prolonges. Les mandibules plus courtes. Les articles du funicule moins longs. Le petiole plus large derriere.

License not applicable

Santschi, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

- [[ soldier ]]. Couleur et sculpture un peu plus foncee et un peu plus forte que chez ce que je considere comme burmeisteri , n. sp. de Cote d'Or (recu de M. Wasmann), mais la pilosite est plus abondante, surtout sur le pedicule et le gastre (a peu pres glabre chez burmeisteri ). La tete est un peu plus etroite en avant, le pedicule plus long et plus etroit. Les cotes du pots-petiole plus arrondis. Les [[ worker ]] de 6.5 mill. ont la tete tres luisante et elle l'est encore chez les [[ worker ]] de 4 mi 1.

 

Casamance (M. Claveau), une dizaine d'exemplaires de toutes tailles.

License not applicable

Santschi, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

- J'ai examine un assez grand nombre d'exemplaires de cette variete recus autrefois du Congo francais et du Cameroun, ainsi que les types que le R. P. Wasmann a bien voulu me communiquer. Ils me paraissent constituer une transition entre burmeisteri et sjoestedti . La sculpture assez mate et les cotes un peu arques de la tete chez les [[ soldier ]] rappellent la race sjoestedti , mais ce sont la des caracteres assez inconstants, les plus grands exemplaires (11 mill.) ont une tendance a avoir le vertex et les cotes de la tete assez luisants, tandis qu'ils restent toujours opaques chez Sjoestedti . D'autre part, la forme de la tete chez les ouvrieres de moyenne longueur (entre 6 et 7 mill.) reste, chez rufescens , identique a celle des ouvrieres de toutes les varietes de la race burmeisteri , c'est-a-dire bien plus large, plus courte, plus luisante et relativement plus robuste que chez sjoestedti , de meme taille, le penultieme article du funicule a peine deux fois plus long qu'epais (trois fois chez sjoestedti de 7 mill.). La forme du pedicule varie un peu: il est tantot aussi long que chez sjoestedti , tantot comme chez burmeisteri . Je rattache donc celte forme comme variete de a burmeisteri . Du reste, j'ai sous les yeux toutes les transitions entre rubella et rufescens , parmi lesquelles je crois pouvoir distinguer une variete - ornatan. var. - qui rappelle rufescens par sa couleur et sa forme, mais dont la tete est luisante chez les individus de toutes tailles, comme chez rubella . Je regarde comme type de la var. ornata des exemplaires du Cameroun (communiques par M. Emery), dont la couleur rouge vif tranche nettement avec le noir des angles anterieurs de la tete.

License not applicable

Santschi, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

- Cette race varie un peu, des exemplaires du Dar Benda ont chez le soldat (12.5 mill.) la tete presque aussi large que longue (largeur 3.5 mill) et les cotes plus convexes que chez ceux du Cameroun. En outre, quoique entierement mate, la tete est moins opaque et le pedicule a les angles posterieurs aussi saillants que chez molesta , ce qui n'est pas le cas chez le type. Les mandibules sont toujours plus larges que chez arcens et burmeisteri avec un bord interne un peu deprime, prismatique, les deux tiers externes sont plus arques que chez arcens mais moins que chez burmeisteri .

 

Les [[ worker ]] de 7 mill. ont la tete bien plus allongee que chez burmeisteri et ses varietes de meme taille, elle est en outre relativement plus petite et moins robuste, puis ce n'est qu'en dessous de 5 mill. qu'elle commence a devenir luisante. En outre, le penultieme article du funicule est environ trois fois aussi long qu'epais.

 

Dar Benda meridional, Krebedje (Fort Sibut) Mission Charri Tchad (Dr J. Decorse.) Museum de Paris. - Cameroun Molunda (Reichensperger) et types du Cameroun aimablement communiques par M. le Prof. C. Emery.

License not applicable

Santschi, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

— [[ male ]]. — Sankuru, Kassai, Congo beige (Luja).

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

— [[ male ]]. — Congo (Deleval);

 

Mayumbe (Cabra); Chikai (Cabra); Mukonje Farm, Kamerun (R. Rohde); Zambi (don Lopez).

 

Les deux types de Mukonje Farm semblent etre la var. funereus Emery.

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

, rougeatre et mate, plus repandue, atteignant 2.400 m. au pic de Fernando Poo. LAMOTTE n'en a pris que de petites ouvrieres dans des releves de detail, et n'a pas du la rencontrer en colonne Yanle (commun), Nion, N'Zo (plus rare), Camp I du Mont To (1.600 m.), abondante. On rattache habituellement a cette race la banale var. molesta , que je placerai, d'apres SANTSCHI, avec l'espece suivante:

License not applicable

Bernard, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

, noire et plus mate', tete plus convexe: une grosse ouvriere typique de Yalanzou; race purement occidentale;

License not applicable

Bernard, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Le plus commun et le plus nuisible des Anomma . La nomenclature de ses nombreuses varietes est confuse et meritera une mise au point quand tous les males seront connus. Les captures locales comprennent au moins 3 formes:

 

D. nigricans typique, roux-fonce, tete souvent noire. Abondant a N'Zo, 500 m. Quelques ouvrieres de Yanle (st. F 19);

License not applicable

Bernard, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mag. Insekten, vol. I, p. 188 (1802), [[male]]. - Emery, apud P. Wytsman, Genera lnsectorum, Formicidae, subfam. Dorylinae, fasc. CII, p. 12 (1910).

 

Uganda central: M'Bale (1909), 1 [[male]].

 

Distribution geographique. -Afrique occidentale: Congo, surtout dans le bassin du Niger.

License not applicable

Santschi, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dorylus nigricans

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTATAATTGGGGGTTTTGGTAATTTTATTGCACCTTTAATGATTGGAGCCCCTGACATAGCATATCCTCGAATAAATAATATAAGATTTTGACTCCTCCCCCCCTCAATTACTTTAATAATTATAAGAAATTTCATTAATATAGGATCAGGAACTGGTTGAACTGTATACCCACCTTTAGCCTCAAATATTTACCATAATGGACCATCAATTGATTTAACTATTTTTTCTTTACATATTGCAGGGATATCATCAATTTTAGGAGCCATTAATTTTATCTCAACAATCATTAATATACATCATAAAAATTTAACTATAGATAAAACTCCATTATTTGTTTGATCGATCCTAATTACAGCAATTCTTTTACTTCTTTCATTACCAGTTTTAGCAGGAGCAATTACCATATTATTAACTGATCGTAATATTAATACATCATTTTTTGATCCATCAGGAGGAGGCGATCCTATTTTATATCAACATTTATTTTGATTTTTCGGTCATCCTGAAGTTTATATTTTAATTTTACCTGGGTTTGGTATAATTTCACATATTATTTCAAATGAAAGAGGAAAGAAAGAAACATTTGGTTCATTAAGAATAATTTATGCATTAATAGCTATTGGATTTTTAGGATTTATTGTATGAGCTCATCACATATTTACAGTAGGTATAGATGTAGATACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dorylus nigricans

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!