Articles on this page are available in 1 other language: French (1) (learn more)

Overview

Comprehensive Description

Taxonomic History

1 subspecies

Dorylus (Dorylus) spininodis Emery, 1901l: 194, pl. 1, figs. 18-20 (w.) CAMEROUN. AntCat AntWiki

Taxonomic history

Current subspecies: nominal plus Dorylus spininodis longiceps.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Santschi, F., 1914:
 Mem. Accad. Sc. Bologna, (5), vol. 9. p. 426, pl. i, fig. 18-21 (1901), [[worker]].
 Uganda occidental, province de Toro: environs de Fort-Portal(1909), 1 [[worker]].
 Distribution geographique: Cameroun (type), Benin.
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mem. Accad. Sc. Bologna, (5), vol. 9. p. 426, pl. i, fig. 18-21 (1901), [[worker]].

 

Uganda occidental, province de Toro: environs de Fort-Portal(1909), 1 [[worker]].

 

Distribution geographique: Cameroun (type), Benin.

License not applicable

Santschi, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dorylus spininodis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTTGCTTTATGATCAGGAATTTTAGGATCATCAATAAGATTAATTATTCGTTTAGAATTAGGAACTTGTGGAACAATAATTTTTAAT---GATCAAGTTTTTAATTCTATTGTAACTAGACATGCTTTTATTATAATTTTTTTTATAGTTATACCTTTTATAATTGGAGGATTTGGTAATTTTATTGCCCCTTTAATAATTGGAGCTCCAGATATAGCATACCCCCGAATAAATAATATAAGATTTTGATTACTACCCCCTTCTATTACTTTAATAATTAGAAGAAATTTTATTAATATAGGCCCTGGTACTGGTTGAACAGTTTATCCTCCTCTAGCTTCAAATATTTATCATAATGGACCTGCCATTGATTTAACTATTTTTTCATTACATATTGCAGGAATATCTTCAATTTTAGGAGCAATTAATTTTATTTCAACAATTATAAATATACATCATAAAAACTTAACTATAGATAAAACTCCATTATTTGTTTGATCAATTTTAATTACAGCTATTCTTTTATTATTATCCTTACCTGTATTAGCTGGTGCAATTACTATATTATTAACTGATCGAAATATTAATACTTCATTTTTTGATCCTTCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dorylus spininodis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!