Overview

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Apamea cariosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACCTCTTTAAGTTTACTTATTCGTGCTGAATTGGGAAACCCCGGATCCTTAATTGGCGATGATCAAATTTATAATACTATTGTTACAGCCCATGCTTTCATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTGGTACCACTAATATTAGGGGCTCCTGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGATTATTGCCCCCCTCTTTAACTTTATTAATCTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGTTGAACAGTGTACCCCCCACTTTCATCTAATATTGCTCATGGAGGAAGTTCTGTAGATTTAGCTATTTTTTCCCTCCATTTAGCTGGAATCTCCTCTATTTTAGGAGCTATTAATTTCATCACTACAATTATTAACATACGATTAAATAGTTTATCTTTTGATCAAATACCTTTATTTATTTGAGCTGTAGGGATTACTGCATTCTTATTATTATTATCTTTACCTGTTTTAGCGGGAGCTATTACAATACTGTTAACAGATCGAAATTTAAATACATCATTTTTTGACCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Apamea cariosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Apamea cariosa

Apamea cariosa is a moth of the Noctuidae family. It is found in the north-eastern parts of the United States, including New York, Maryland, Indiana and Virginia. In Canada it is found in Ontario, Quebec, New Brunswick, Alberta and Manitoba.

The wingspan is about 35 mm.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!