Articles on this page are available in 1 other language: French (1) (learn more)

Overview

Comprehensive Description

Taxonomic History

2 subspecies

Formica herculeana Linnaeus, 1758 PDF: 579 (q.) EUROPE. AntCat AntWiki

Taxonomic history

Combination in Camponotus: Mayr, 1861 PDF: 36; in Camponotus (Camponotus): Forel, 1914a PDF: 259.
Senior synonym of Camponotus atra, Camponotus intermedia: Nylander, 1846a PDF: 894; of Camponotus castanea: Mayr, 1863a PDF: 399; of Camponotus whymperi: Creighton, 1950a PDF: 367; of Camponotus nadigi: Yasumatsu & Brown, 1951: 30; of Camponotus montanus, Camponotus shitkowi: Emery, 1925d PDF: 72; Karavaiev, 1936: 178; Arnol'di, 1967 PDF: 1819; of Camponotus caucasicus: Arakelian, 1994 PDF: 85; of Camponotus eudokiae: Radchenko, 1997B PDF: 555.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Forests & alpine grasslands
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

31. Camponotus herculeanus HNS (Linne, 1758)

Figs. 121,123.

Formica herculeana horni HNS , 1758:579.

Workers. Bicoloured with alitrunk dull red to reddish black, head and gaster dull black.

Frons has deep close set punctures. Long pubescence on dorsum of first gaster tergite overlapping posterior border. Length: 5-12 mm.

Queen. Sides of alitrunk, propodeum and scale dull red, rest black; punctures and pubescence as in worker. Length: 14-17 mm.

Male. Entirely black, tarsi and funiculi paler; wings yellowish infuscate; head and gaster hairs sparse but present on all gaster tergitcs. Petiole scale has shallow dorsal emargination with raised sides rounded to blunt lateral angles.

Distribution. Throughout Fennoscandia; local in Denmark and absent from the British Isles. - Range: throughout mountain Europe and extending through Northern Eurasia from Norway to Eastern Siberia to the northernmost tree frontier in Arctic Norway.

Biology. This species is a typical denizen of shaded coniferous forest nesting in rotten stumps and occasionally mining in living trees. Fertilised females found nests singly. Alatae are developed in the late summer but overwinter to swarm in June.

  • Collingwood, C. A. (1979): The Formicidae (Hymenoptera) of Fennoscandia and Denmark. Fauna Entomologica Scandinavica 8, 1-174: 90-91, URL:http://antbase.org/ants/publications/6175/6175.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mostly Alpine SLO, above 1000 m alt.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Forel, A., 1904:
 Caucase septentrional, district Maikop, mont Bambak, 2 [[ queen ]], 30. VIII. 1894 (S. Prichodko!); Transcaucasie, Gouv. Kutais, Artvin, 1 [[ queen ]], 23. VI. 1888 (Derjugin!); Turkestan, Ferghana, fl. Kugart, 7000 ' h., 2 [[ queen ]], 5. VIII. 1895
 (KoRZINSKIj!).
 Siberie de sudouest, Semireeje, Przevalsk, 1 [[ worker ]] (Kucenko!).
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Records

 

(Map 59): Bulgaria ( Agosti and Collingwood 1987a , Atanassov and Dlusskij 1992 ); Stara Planina Mts ( Seifert 1989 ); Western Stara Planina Mts: Vilya-glava mine ( Atanassov 1934 ); Sofia Basin: Sofia ( Atanassov 1934 ); Vitosha Mt. ( Atanassov 1936 , 1952 ); Plana Mt.: above Dyavolski most bridge (Kokalyane vill.), Bukov dol loc. (Pasarel vill.), Peyova buka hut (Pasarel vill.) ( Vagalinski and Lapeva-Gjonova in press ); Ihtimanska Sredna Gora Mts: Benkovski peak ( Atanassov 1934 ); Strandzha Mt.: Papia peak ( Atanassov 1934 ); Belasitsa Mt. ( Atanassov 1964 ); Krupnik-Sandanski-Petrich Valley: along Luda Mara river ( Atanassov 1964 ); Rila Mt. ( Seifert 1989 ): Elenin peak, Rilska river valley ( Forel 1892 ), Borovets ( Atanassov 1934 , 1936 ), Kostenets ( Atanassov 1934 ); Pirin Mt. ( Seifert 1989 ): Bansko-Banderitsa ( Atanassov 1934 ); Rhodopi Mts ( Seifert 1989 ); Western Rhodopi Mts: Karlak peak (Atanasov 1934), Perelik peak ( Atanassov 1936 ), Rakitovo, Batak ( Lapeva-Gjonova in press (a) ); Southern Black Sea coast: Maslen nos ( Atanassov 1934 ).

 

Notes:

 

Camponotus herculeanus is aboreo-montane species and its record from "Maslen nos" seems doubtful.

License not applicable

Lapeva-Gjonova, Albena

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Caucase septentrional, district Maikop, mont Bambak, 2 [[ queen ]], 30. VIII. 1894 (S. Prichodko!); Transcaucasie, Gouv. Kutais, Artvin, 1 [[ queen ]], 23. VI. 1888 (Derjugin!); Turkestan, Ferghana, fl. Kugart, 7000 ' h., 2 [[ queen ]], 5. VIII. 1895

 

(KoRZINSKIj!).

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 4 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Camponotus herculeanus preys on:
various

Based on studies in:
USA: North Carolina (Forest, Plant substrate)

This list may not be complete but is based on published studies.
  • H. E. Savely, 1939. Ecological relations of certain animals in dead pine and oak logs. Ecol. Monogr. 9:321-385, from pp. 335, 353-56, 377-85.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Camponotus herculeanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 34
Specimens with Barcodes: 254
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Camponotus herculeanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 57 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGATCCTCTATAAGAATGATCATTCGACTAGAATTAGGATCTCCTGATTCATTAATTCTCAAT---GATCAAACTTTTAATACCATCGTTACAAGTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCTTTTATAATTGGGGGATTTGGTAATTTTCTAATCCCACTTATACTAGGATCTCCTGATATGGCTTACCCACGTTTAAATAACATAAGATTTTGATTACTCCCCCCATCAATCTCCTTATTAATCCTAAGAAATTTTATTAATGAAGGATCAGGAACTGGTTGAACTATCTACCCCCCCTTATCATCAAATACCTTCCATAGTGGCCCCTCTATTGACCTAACTATCTTTTCTCTCCATATTGCTGGTATATCCTCAATTATAGGAGCAATCAATTTTATTTCAACAATTATAAATATACATAACTCCAATATTTCCTTGGATAAAATTCCCTTATTAGTATGGTCCATTCTTATTACAGCCATTCTCCTTCTTCTATCCCTACCTGTTCTAGCAGGAGCTATTACAATACTATTAACAGACCGAAATCTTAATACTTCATTTTTCGACCCTTCGGGAGGAGGGGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTATATATTTTAATTCTCCCTGGATTTGGTTTAATCTCTCATATTATCATAAATGAAAGGGGAAAAAAAGAAACCTTTGGGGCCCTTGGAATAATTTATGCAATTATTACAATTGGATTTTTAGGATTTATTGTTTGAGCTCACCATATATTCACTATTGGTCTAGATATTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus herculeanus Q. sp. 01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Subgenus: Camponotus

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!