Overview

Comprehensive Description

Taxonomic History

2 subspecies

Formica herculeana Linnaeus, 1758 PDF: 579 (q.) EUROPE. AntCat AntWiki

Taxonomic history

Combination in Camponotus: Mayr, 1861 PDF: 36; in Camponotus (Camponotus): Forel, 1914a PDF: 259.
Senior synonym of Camponotus atra, Camponotus intermedia: Nylander, 1846a PDF: 894; of Camponotus castanea: Mayr, 1863a PDF: 399; of Camponotus whymperi: Creighton, 1950a PDF: 367; of Camponotus nadigi: Yasumatsu & Brown, 1951: 30; of Camponotus montanus, Camponotus shitkowi: Emery, 1925d PDF: 72; Karavaiev, 1936: 178; Arnol'di, 1967 PDF: 1819; of Camponotus caucasicus: Arakelian, 1994 PDF: 85; of Camponotus eudokiae: Radchenko, 1997B PDF: 555.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

 

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Forests & alpine grasslands
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

 

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mostly Alpine SLO, above 1000 m alt.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

 

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Forel, A., 1904:
 Caucase septentrional, district Maikop, mont Bambak, 2 [[ queen ]], 30. VIII. 1894 (S. Prichodko!); Transcaucasie, Gouv. Kutais, Artvin, 1 [[ queen ]], 23. VI. 1888 (Derjugin!); Turkestan, Ferghana, fl. Kugart, 7000 ' h., 2 [[ queen ]], 5. VIII. 1895
 (KoRZINSKIj!).
 Siberie de sudouest, Semireeje, Przevalsk, 1 [[ worker ]] (Kucenko!).
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

 

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Records

 

(Map 59): Bulgaria ( Agosti and Collingwood 1987a , Atanassov and Dlusskij 1992 ); Stara Planina Mts ( Seifert 1989 ); Western Stara Planina Mts: Vilya-glava mine ( Atanassov 1934 ); Sofia Basin: Sofia ( Atanassov 1934 ); Vitosha Mt. ( Atanassov 1936 , 1952 ); Plana Mt.: above Dyavolski most bridge (Kokalyane vill.), Bukov dol loc. (Pasarel vill.), Peyova buka hut (Pasarel vill.) ( Vagalinski and Lapeva-Gjonova in press ); Ihtimanska Sredna Gora Mts: Benkovski peak ( Atanassov 1934 ); Strandzha Mt.: Papia peak ( Atanassov 1934 ); Belasitsa Mt. ( Atanassov 1964 ); Krupnik-Sandanski-Petrich Valley: along Luda Mara river ( Atanassov 1964 ); Rila Mt. ( Seifert 1989 ): Elenin peak, Rilska river valley ( Forel 1892 ), Borovets ( Atanassov 1934 , 1936 ), Kostenets ( Atanassov 1934 ); Pirin Mt. ( Seifert 1989 ): Bansko-Banderitsa ( Atanassov 1934 ); Rhodopi Mts ( Seifert 1989 ); Western Rhodopi Mts: Karlak peak (Atanasov 1934), Perelik peak ( Atanassov 1936 ), Rakitovo, Batak ( Lapeva-Gjonova in press (a) ); Southern Black Sea coast: Maslen nos ( Atanassov 1934 ).

 

Notes:

 

Camponotus herculeanus is aboreo-montane species and its record from "Maslen nos" seems doubtful.

License not applicable

Lapeva-Gjonova, Albena

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caucase septentrional, district Maikop, mont Bambak, 2 [[ queen ]], 30. VIII. 1894 (S. Prichodko!); Transcaucasie, Gouv. Kutais, Artvin, 1 [[ queen ]], 23. VI. 1888 (Derjugin!); Turkestan, Ferghana, fl. Kugart, 7000 ' h., 2 [[ queen ]], 5. VIII. 1895

 

(KoRZINSKIj!).

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 4 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Camponotus herculeanus preys on:
various

Based on studies in:
USA: North Carolina (Forest, Plant substrate)

This list may not be complete but is based on published studies.
  • H. E. Savely, 1939. Ecological relations of certain animals in dead pine and oak logs. Ecol. Monogr. 9:321-385, from pp. 335, 353-56, 377-85.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Camponotus herculeanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 57 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGATCCTCTATAAGAATGATCATTCGACTAGAATTAGGATCTCCTGATTCATTAATTCTCAAT---GATCAAACTTTTAATACCATCGTTACAAGTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCTTTTATAATTGGGGGATTTGGTAATTTTCTAATCCCACTTATACTAGGATCTCCTGATATGGCTTACCCACGTTTAAATAACATAAGATTTTGATTACTCCCCCCATCAATCTCCTTATTAATCCTAAGAAATTTTATTAATGAAGGATCAGGAACTGGTTGAACTATCTACCCCCCCTTATCATCAAATACCTTCCATAGTGGCCCCTCTATTGACCTAACTATCTTTTCTCTCCATATTGCTGGTATATCCTCAATTATAGGAGCAATCAATTTTATTTCAACAATTATAAATATACATAACTCCAATATTTCCTTGGATAAAATTCCCTTATTAGTATGGTCCATTCTTATTACAGCCATTCTCCTTCTTCTATCCCTACCTGTTCTAGCAGGAGCTATTACAATACTATTAACAGACCGAAATCTTAATACTTCATTTTTCGACCCTTCGGGAGGAGGGGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTATATATTTTAATTCTCCCTGGATTTGGTTTAATCTCTCATATTATCATAAATGAAAGGGGAAAAAAAGAAACCTTTGGGGCCCTTGGAATAATTTATGCAATTATTACAATTGGATTTTTAGGATTTATTGTTTGAGCTCACCATATATTCACTATTGGTCTAGATATTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camponotus herculeanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 30
Specimens with Barcodes: 246
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Subgenus: Camponotus

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!