Overview

Comprehensive Description

External Appearance

Body very long and slender, somewhat flattened below, irregular and ungraceful in form, and sluggish in movement. Head slightly broader than rest of body; snout blunt, posterior extremity of body tapering gradually to a point. The common opening of the mouth and proboscis lies ventrally a little back from the tip of the snout. The cerebral sensory organs lie far in front of the brain, and each communicates with the exterior by a canal which opens on the ventro-lateral margin near the tip of the snout. Uniform dark green above and nearly white below; sometimes greyish or yellowish green above, and very pale yellowish green below. The color of Alaska specimens is as a rule paler and more greyish green than in Mediterranean specimens. The head is bordered with a narrow band of white, uniform with that of hte lower surface. Back of the head is an inconspicuous transverse band paler than the rest of the dorsal surface. The pigment resides wholly in the integument, the muscular layers and other organs of the body being practically colorless.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Sensory Organs

The eyes are characteristically arranged in two groups on each side of the head. The anterior group on each side usually consists of 8 to 10 pigment-cups arranged in a single row near the antero-lateral border of the head. These lie deeply imbedded in the tissues of the head, and are much more conspicuous from the ventral surface owing to the presence of much pigment on the dorsal surface above them in ordinary states of contraction. Each posterior group lies nearly above the brain and consists of 10-20 ocelli in an irregular cluster. The eyes of the posterior groups are visible only from the dorsal surface, and the smaller in size than those of the anterior groups. The integument may be scraped off so as to expose the eyes clearly.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Proboscis and Rhynchocoel System

The stylet apparatus is especially characeristic of the species. The basis
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 10.151 - 10.151
  Nitrate (umol/L): 6.725 - 6.725
  Salinity (PPS): 31.893 - 31.893
  Oxygen (ml/l): 6.561 - 6.561
  Phosphate (umol/l): 0.943 - 0.943
  Silicate (umol/l): 15.658 - 15.658
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Emplectonema gracile

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCGATGATTTTTTTCTACAAATCATAAAGATATTGGTTCTTTGTATTTTTTATTTGGAGTTTGGTCTGGTTTGGTTGGTACTGCTTTAAGTTTACTTATTCGAGCTGAGCTCGGGCAGCCGGGCGCCCTTCTAGGTGATGATCAACTATATAACGTTATTGTTACCGCTCATGCTTTTGTCATAATTTTTTTTCTGGTTATACCTGTAATAATTGGTGGTTTTGGAAATTGGTTAGTTCCTTTAATGTTAGGTGCTCCTGACATAGCTTTTCCTCGGATAAATAATATGAGATTCTGGCTGCTTCCGCCTGCTCTTGTGTTGCTTTTGTCTTCTGGGGCTGTGGAAAGCGGAGCTGGTACTGGTTGAACTGTTTACCCTCCTTTGTCAAGTAATGTTGCTCACGCTGGAGGTTCAGTAGACCTAGCTATTTTTTCTTTACATTTAGCTGGAGTTTCTTCTATTTTAGGGGCTATTAATTTTATTACTACAATTGTAAACATGCGTTGAAATGGAATGCAATTTGAGCGACTTTCTCTTTTTGTTTGATCTGTAAAGATTACTGCTATTTTATTACTTTTATCTCTTCCTGTTTTAGCTGGTGCTATTACGATACTTCTAACTGATCGAAATTTTAATACTTCTTTTTTTGACCCAGCCGGTGGAGGAGACCCTATTTTGTATCAACATTTATTTTGATTTTTTGGACATCCTGAGGTTTATATTTTGATCCTGCCTGGATTTGGAATGATTTCTCATATTGTTAACCACTATTCAGTTAAAAAAGAGGCTTTTGGTCATTTAGGAATAATCTATGCTATACTAGCAATTGGTTTGCTTGGATTTGTTGTTTGAGCTCACCATATGTTTGTCGTGGGGATAGATGTCGACACTCGAGCTTATTTTACAGCTGCAACTATAATTATTGCTGTTCCTACTGGAATTAAGGTTTTCAGCTGGTTAGCTACAATTCACGGTTCTTTCGTTAAATATGAAGCTCCTATGCTTTGAGCTTTAGGATTTATTTTTCTTTTTACTGTAGGAGGGCTTACTGGGATTATACTTGCAAATTCTAGGATTGATATTGTGCTTCATGATACTTATTATGTTGTAGCTCATTTTCATTATGTGTTATCTATGGGGGCCGTTTTTGCTCTATTTGGTGGTTTCAATTATTGATTTCCATTAATTACTGGTTTAACCCTTAACACTCGTTGAGCTAAATCTCATTTTTTTATTATGTTTTTAGGTGTAAATTTGACCTTTTTTCCTCAACACTTTTTAGGTTTGGGAGGGATGCCTCGTCGTTATTCCGATTACCCTGATGTTTTTATAAAATGAAATGTTGTTTCCTCTGCAGGGTCTTTAGTTTCTTTTGTGGCTGTTCTTTATTTTATATTTATTGTTTGAGAAAGTTTTATTTCACAACGAGGAGTAGTGTGCTCTTCTCATTTAGGAACTGTTTTAGAGTGGGATAACCGTTTACCTGCAGATTTTCACAATGAGAGAGAGACAGGATCTGTGGTGATGATTTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Emplectonema gracile

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!