Overview

Comprehensive Description

External Appearance

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)
Head very variable in shape, commonly wider than the portion of body immediately following; flattened, sometimes sharply demarcated by lateral constrictions. Tip of snout pointed, rounded, or emarginate according to the state of contraction. On each side of the head is an inconspicuous V-shaped furrow, with the ends pointing obliquely forward above and bow. The upper limb of the furrow reaches into the dark color of the dorsal surface, where it is sometimes conspicuous from its light color.

The color varies considerably but is commonly homogeneous dark brown, orange brown, or purplish brown above and on the sides while the ventral surface is opaque white or whitish yellow. In most specimens the dark purple of the dorsal surface encroaches considerably on the ventral surface, shading gradually into whitish or yellowish. Seen from the ventral surface therefore the worms appear dull white or yellowish white, with a wide border of dark purple. Oftentimes the whitish color occupies scarily more than the median third of the ventral surface, and on the head it covers also the sides and front. The head is dark purplish brown above, bordered in front and laterally by the light color of the ventral surface. At the posterior border of the head is a small angular spot on each side corresponding in color with that of the ventral surface. Behind the head is a narrow, V-shaped dorsal marking, usually of lighter color, with its ends pointed forward and outward. In paler individuals the pinkish color of the brain lobes can be distinguished. The natural color of the body is well retained in formalin or alcohol.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Description

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)

Body moderately elongated. Proboscis sheath about 1/2 to 3/4 the length of the body. Central stylet well developed.

Two or 4 pouches of accessory stylets. Color purplish brown, dark-brown, or orange-brown above, on sides, and on lateral margins of ventral surface; rest of the ventral surface (often only the median third) white or yellowish white.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology/Natural History: This common species feeds on polychaetes, especially nereids, at low tide. At high tide it remains mostly under cover but it is often seen crawling along rocks or mud, hunting during early-morning or nighttime low tides. It can swallow prey slightly larger than itself. In Washington a primary prey species is the small nereid Platynereis bicanaliculata which builds small tubes on Ulva, while in Alaska Nereis vexillosa is common prey. Many Nereids show strong escape behavior after coming in contact with P. peregrina. It seems to need to actually physically contact prey in order to detect its presence. On contact with nereid prey, P. peregrina pulls its head back and everts its light-colored proboscis, which wraps around the prey. The prey is soon paralyzed, probably by the alkaloid neurotoxin anabaseine from the stylet or from posterior proboscis glands. P. peregrina then swallows the nereid. After feeding it follows its own slime trail back to its burrow. It eats about one prey worm per day and seems to reuse its stylet on multiple prey. It can readily be induced to attack nereid worms in a laboratory dish. It sometimes also preys on nephtyid, syllid, or spionid worms as well.

Exposure to fresh water may trigger eversion of the proboscis. In many populations, many more females are found than males. Spawning is mostly in spring and summer but may extend through the fall and into winter. Populations in any one place tend to spawn within about a month of each other. The orange-brown eggs are deposited singly or in gelatinous clusters and hatch in about 3 days. Worms live about 1 1/2 years.

Some evidence suggests that anabaseine may be useful against Alzheimer's disease in humans.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

As a member of Class Enopla, the mouth and proboscis pore are united and at the anterior tip of the head (photo) and the proboscis is armed with a stylet. In P. peregrina the stylet has a substantial shaft with helical grooves and ridges. The proboscis sheath is more than 1/5 the length of the body. Typically there are 2-3 sacs of reserve stylets, with about 4 stylets in each sac. Has numerous ocelli, but these do not extend behind the cerebral ganglia. It does not have a statocyst. The species does not usually live commensally with other species such as crustaceans or clams. Dorsal surface is brown to purplish-brown (sometimes orange-brown) and the ventral surface is yellow to creamy white. There is a lighter dorsal band near the borders and back of the head which extends across the posterior groups of ocelli (about 5-12 ocelli on each side). The tail may be pointed. Up to over 25 cm long but usually 6-15 cm.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographical Range: Japan; Kamchatka; Aleutian Islands, Alaska to Ensenada, Baja California, Mexico

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Blood Vascular System

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)
There is a pair of large blood lacunae in the head as usual; they join anteriorly by a broad anastomosis. The three longitudinal vessels are well developed to the end of the body where they anastomose above the anus. Sometimes the dorsal vessel lies beside or even above the proboscis sheath throughout a portion of its course, instead of below the sheath as usual.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Glands

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)
A crowded mass of multicellular glands occupies the anterior portion of the head. The anterior ones open on the tip of the snout. In the brain region they open mostly on the lateral surfaces of the body, while farther back, and in the esophageal region, they assume the character of submuscular glands. No difference in appearance is noticeable between the cephalic glands and those in the esophageal region. They are present in the esophageal region only about as far back as the openings of the nephridia. Throughout their course the open to the exterior (by innumerable ducts which pass through the muscular and basement layers) on the ventro-lateral aspects of the body.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sensory Organs

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)
Numerous minute eyes are arranged in two groups on each side. Of these, an anterior group of 12 or more small pigment spots are scattered along each side of the antero-lateral margin, while about as many more occupy an irregular cluster on each side just in front of the brain. These latter ocelli are usually well separated from the anterior, or marginal groups.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nervous System

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)
The cerebral sense organs lie well in front of the brain, and external to the blood lacunae. They open into the slight furrow on the lateral aspects of the head a little anterior to their own position. The lateral nerves form a commissure above the anus as usual.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Excretory System

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)
The nephridia occupy the anterior 2/3 of the esophageal region. They are large, with numerous branches lying above the lateral nerves, and frequently passing internally to the nerves and beneath the esophagus. They reach forward nearly to the brain. At about 1/3 of the distance posteriorly the main nephridial tubes, lying above the lateral nerves increase greatly in size and a pair of remarkably large efferent ducts pass externally to the lateral nerves to open on the lateral aspects of the body slightly below the lateral margins. The main duct reaching posteriorly from the point is larger than that in front.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Proboscis and Rhynchocoel System

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)

Proboscis of medium size (as in Amphiporus), slightly yellowish, and usually everted when the animal is killed. The extruded proboscis is short and tic with an unusually slender posterior chamber. The armature consists of a small, slender, shapely pointed central stylet, and with either 2 or 4 pouches of reserve stylets. The basis of the central stylet is very small and slightly enlarged posteriorly; the reserve stylets are slender and sharp like the central one, and commonly number from 6 to 10 in each pouch. When four pouches are present the number of stylets in each is as great as when there are only two pouches. The mouth and proboscis open together, but the rhynchodaeum is short. The proboscis sheath reaches about three-fourths the length of the body, or sometimes more than three-fourths. In each of four specimens sectioned there were 14 conspicuous nerves in the proboscis. The proboscis has a remarkable narrow ring of gland cells on the periphery near the posterior end of the basis of the central stylet.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Digestive System

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)
A pair of slender branches of the intestinal caecum reach forward nearly to the brain commissures and lie well above the lateral nerve cords. at about the point of the nephridial openings these branches pass ventrally and occupy a position beneath the esophagus. Another pair, coming forward from behind, take their places. The ventral branches join to form the main median caecum, from which short branches pass obliquely forward and dorsally at intervals. in cross section two pairs of these lies above and one below the lateral nerves. They are disposed in such a way that one pair ends at about the point where the second pair anterior originates. The branches are only irregularly arranged in pairs. The esophagus opens into the dorsal wall of the main caecum.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)
Individuals of all sizes from 20-400 mm were met with, but the most common size was about 150 mm in extension. The width was commonly about 5 mm.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

How to Distinguish from Similar Species: Emplectonema purpuratum may also be purple or brownish-purple but it is much longer and often has light brown specks. Paranemertes sanjuanensis is similar in structure but is colored pale orange to flesh color.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)
This is the restless nemertean, and on cloudy days was frequently met with crawling about over the stones on the beach between tides--which peculiarity has suggested its specific name. It was found abundantly at nearly all the collecting stations from Victoria, B.C. to Unalaska Island, and is one of the commonest nemerteans of the coast. It occurs from low tide well up toward high water mark in every variety of location--under stones, among seaweeds, barnacles, mussels, etc. The individuals are very voracious feeders, and were taken not infrequently with partially swallowed Chaetopods. Their tenacity of life is remarkable--they will live for days in a small quantity of filthy water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 10.151 - 10.151
  Nitrate (umol/L): 6.725 - 6.725
  Salinity (PPS): 31.893 - 31.893
  Oxygen (ml/l): 6.561 - 6.561
  Phosphate (umol/l): 0.943 - 0.943
  Silicate (umol/l): 15.658 - 15.658
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth Range: Mid and low intertidal; shallow subtidal

Habitat: Under rocks and under algae on wave-swept shores; or in the Pacific Northwest most commonly within or on muddy sediments or under stones in quieter environments.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Reproductive System

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)
The sexual products were nearly mature in June and July. They are formed in numerous pouches which surround the intestinal canal on all sides. In a male as many as twenty sexual pouches were seen in a single section. They open directly to the exterior, whatever be their position.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Paranemertes peregrina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TCTTTATATTTTTTATTTGGGGTGTGGTCAGGTTTGGTTGGGACTGCTTTAAGGTTGTTGATTCGTGCTGAGCTTGGGCAGCCTGGGGCTCTTTTAGGGGAT---GATCAATTATATAATGTTATTGTCACGGCTCATGCTTTTGTAATGATTTTTTTTTTAGTTATGCCCGTAATAATTGGAGGGTTTGGAAATTGATTGGTTCCTTTAATGTTGGGGGCACCTGATATAGCATTTCCTCGTATAAATAATATAAGATTTTGATTGCTGCCACCGGCGTTAGTATTACTTCTATCTTCTGGGGCAGTTGAAAGAGGGGCTGGTACCGGATGAACTGTTTACCCTCCTTTGTCTAGAAATATTGCTCATGCTGGAGGTTCTGTAGATTTAGCTATTTTTTCTCTTCATCTGGCTGGGGTTTCTTCTATTTTAGGTGCTATTAATTTTATTACTACTATTGTTAATATGCGGTGGTATGGAATGCAGTTTGAGCGGTTGTCGTTGTTTGTGTGGTCTGTAAAGATTACGGCCGTTCTTCTTCTTCTTTCCCTTCCAGTTTTAGCTGGGGCAATTACAATATTATTAACAGATCGGAATTTTAATACTTCTTTTTTTGACCCTGCTGGTGGGGGAGACCCAATTTTATATCAGCATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Paranemertes peregrina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!