Articles on this page are available in 2 other languages: French (7), German (1) (learn more)

Overview

Comprehensive Description

Technomyrmex albipes HNS (F. Smith, 1861)

(Fig. 5)

Tramp species, in hothouses, Palaearctic, potentially to be imported to the New World.

  • Fernández, F., Guerrero, R. J. (2008): Technomyrmex (Formicidae: Dolichoderinae) in the New World: synopsis and description of a new species. Revista Colombiana de Entomologia 34, 110-115: 111-111, URL:http://hdl.handle.net/10199/19082
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Taxonomic History

Formica (Tapinoma) albipes Smith, 1861b PDF: 38 (w.) INDONESIA (Sulawesi). AntCat AntWiki

Taxonomic history

Forel, 1891c PDF: 98 (q.); Strongylognathus testaceus. Bulletin de la Société Vaudoise des Sciences Naturelles 44:1-22. [1908-03]">Forel, 1908b PDF: 21 (ergatoid m.); Karavaiev, 1926d PDF: 441 (m.); Wheeler & Wheeler, 1951 PDF: 205 (l.); Crozier, 1969a PDF: 245 (k.).
Combination in Tapinoma: Mayr, 1863a PDF: 455; in Technomyrmex: Emery, 1888d PDF: 392.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Oahu, Maui, Hawaii
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Diagnosis among workers of introduced and commonly intercepted species. Antenna 12-segmented. Antennal scape length less than 1.5x head length. Eyes medium to large (greater than 5 facets); eye length not distinctly greater than length of erect hairs on frontal carinae. Antennal sockets and posterior clypeal margin separated by a distance less than the minimum width of antennal scape. Mandible lacking distinct basal angle. Dorsum of mesosoma with metanotal groove, but never with a deep and broad concavity; erect hairs present. Propodeum and petiolar node both lacking a pair of short teeth. Propodeum lacking posteriorly projecting protrusion; with dorsal surface distinctly shorter than posterior face. Waist 1-segmented (may be hidden by gaster). Petiolar node appearing flattened. Gaster armed with ventral slit; with five plates on its dorsal surface. Distinct constriction not visible between abdominal segments 3+4. Dorsum of head lacking erect hair posterior to eye. Pronotum with 2 pairs of erect hairs. Mesonotum lacking erect hairs. Propodeum with 2 pairs of erect hairs. Color uniformly dull brown with paler antennae, trochanters and tarsi; hind tarsus distinctly lighter in color than hind femur.


Technomyrmex albipes can be distinguished from Brachymyrmex species, with which it bears superficial resemblance, by the 12-segmented (versus 9-segmented) antenna, and by the presence of a ventral slit (versus acidopore) on the gaster tip. It can be differentiated from Technomyrmex species by the absence (versus presence) or erect hairs on the mesosoma, and by the gaster which has 4 plates on the dorsal surface and 6 on the ventral surface (versus 5 plates on both surfaces). It is most easily differentiated from Tapinoma sessile by the bicolored with dark head and light body, gaster and appendages (versus uniform brown color). Technomyrmex albipes is distinguished from its fellow introduced congeners by the following combination of characters: (1) no erect hairs on head posterior to eye level; (2) 2 pairs of erect hairs on pronotum, 2 pairs of propodeum, no erect hairs on mesonotum,; (3) hind tarsus distinctly lighter in color than hind femur; and (4) eye length not distinctly greater than length of erect hairs on frontal carinae. 

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Antkey

Source: Antkey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Taxonomic Treatment

Emery, C., 1893:
 - Kandy, Cottawa, Matale, Nawalapitiya.
 Le nom de Motschulsky exprime beaucoup mieux la coloration typique de cette espece que celui plus ancien de F. Smith.
 De deux femelles portant des moignons d'ailes, l'une est normale, l'autre a la tete. plus petite, depourvue d'ocelles. Deux autres exemplaires ressemblent a de grosses ouvrieres ayant le mesonotum tres developpe, dont la portion scutellaire fait saillie en arriere.
  M. le professeur A. Forel a decrit, dans le grand ouvrage de Grandidier, sous le nom de T. albipes , une forme de Madagascar qui merite d'etre separee comme sous-espece distincte ( Foreli , n. subsp. ). Elle differe du type indien et malais par ses antennes un peu plus courtes, dont le scape depasse a peine le bord occipital, et par ses antennes et ses pattes entierement testacees. Chez le type, le scape depasse notablement le bord occipital et les pattes sont d'un brun fonce, avec les trochanters, genoux et tarses d'un jaune pale; les scapes sont noirs, le flagellum souvent roussatre.
 

Forel, A., 1909:
 — [[ worker ]].
 

Emery, C., 1895:
 - Vrijburg, Bloemfontein. Identique aux exemplaires de Madagascar, sur lesquels j'ai fonde cette sous-espece.
 

Forel, A., 1912:
 [[ worker ]] [[ queen ]] [[ male ]]. Seychelles: Silhouette, Mare aux Cochons et Mont Pot-a-eau (1000 a 1500 pieds); Mahe, Anonyme Island, Cascade Estate, etc.
 

Fernández, F., 2008:
 (Fig. 5)
 Tramp species, in hothouses, Palaearctic, potentially to be imported to the New World.
 

Forel, A., 1894:
 Indische Art.
 Das nahezu totale Fehlen von Dolichoderiden in der afrikanischen Fauna ist einer ihrer auffaelligsten Zuege. Ich kenne keine einzige Art dieser Subfamilie, die der afrikanischen Fauna eigen waere. Ebensowenig gibt es eigene afrikanische Prenolepis-Arten, waehrend Madagascar sehr reich an eigenen Arten dieser Gattung ist.
 

Forel, A., 1895:
 - Forme de l'Inde et de Madagascar.
 

Forel, A., 1904:
 Lombok, Sapit, 2000 ' h., 11 [[ worker ]], Mai - Juin 1896 (Fruhstorfer!).
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

- Vrijburg, Bloemfontein. Identique aux exemplaires de Madagascar, sur lesquels j'ai fonde cette sous-espece.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indische Art.

 

Das nahezu totale Fehlen von Dolichoderiden in der afrikanischen Fauna ist einer ihrer auffaelligsten Zuege. Ich kenne keine einzige Art dieser Subfamilie, die der afrikanischen Fauna eigen waere. Ebensowenig gibt es eigene afrikanische Prenolepis-Arten, waehrend Madagascar sehr reich an eigenen Arten dieser Gattung ist.

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Technomyrmex sp. 1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Technomyrmex albipes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 26 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATANTATATTTTATTTTTGCTATTTGATCAGGAATAATTGGATCCTCTATAAGAATAATTATTCGTATTGAATTAGGAACTTGTAATTCCTTAATTAATAATGATCAAATCTACAACTCTATTGTTACAAGTCACGCATTTATTATAATTTTTTTTATAGTTATACCATTTATAATCGGTGGGTTTGGAAATTTTTTAGTTCCTTTGATATTAGGGGCCCCAGACATAGCATATCCACGAATAAATAATATAAGATTTTGACTATTACCACCCTCTATTATTATATTAACTATTAGTAATTTAATTGGATCAGGAGTTGGTACCGGATGAACAGTATACCCACCTCTATCATCAAATATTTACCATAATGGACCCTCAGTAGATTTAGCAATTTTTTCTCTTCATATTGCTGGAATATCATCAATCCTAGGAGCTATTAATTTTATTTCAACTATTTTAAACATACACCATAAAAACTTAACTTTAGATAAAATTCCTTTATTAGTCTGATCTATTTTAATTACTGCAATTCTTTTATTACTCTCCCTTCCTGTTTTAGCTGGAGCTATCACCATACTTCTTACAGATCGTAATATTAATACCTCATTTTTTGACCCATGTGGTGGGGGAGACCCAATTTTATATCAACACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Technomyrmex albipes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 27
Specimens with Barcodes: 126
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!