Articles on this page are available in 2 other languages: French (7), German (1) (learn more)

Overview

Comprehensive Description

Technomyrmex albipes HNS (F. Smith, 1861)

(Fig. 5)

Tramp species, in hothouses, Palaearctic, potentially to be imported to the New World.

Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Technomyrmex sp. cf. albipes (F. Smith HNS 1861b)

I [introduced species]

  • Ward, P. S. (2005): A synoptic review of the ants of California (Hymenoptera: Formicidae). Zootaxa 936, 1-68: null, URL:http://antbase.org/ants/publications/21008/21008.pdf
Public Domain

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Taxonomic History

Formica (Tapinoma) albipes Smith, 1861b PDF: 38 (w.) INDONESIA (Sulawesi). AntCat AntWiki

Taxonomic history

Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Oahu, Maui, Hawaii
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Emery, C., 1893:
 - Kandy, Cottawa, Matale, Nawalapitiya.
 Le nom de Motschulsky exprime beaucoup mieux la coloration typique de cette espece que celui plus ancien de F. Smith.
 De deux femelles portant des moignons d'ailes, l'une est normale, l'autre a la tete. plus petite, depourvue d'ocelles. Deux autres exemplaires ressemblent a de grosses ouvrieres ayant le mesonotum tres developpe, dont la portion scutellaire fait saillie en arriere.
  M. le professeur A. Forel a decrit, dans le grand ouvrage de Grandidier, sous le nom de T. albipes , une forme de Madagascar qui merite d'etre separee comme sous-espece distincte ( Foreli , n. subsp. ). Elle differe du type indien et malais par ses antennes un peu plus courtes, dont le scape depasse a peine le bord occipital, et par ses antennes et ses pattes entierement testacees. Chez le type, le scape depasse notablement le bord occipital et les pattes sont d'un brun fonce, avec les trochanters, genoux et tarses d'un jaune pale; les scapes sont noirs, le flagellum souvent roussatre.
 

Forel, A., 1909:
 — [[ worker ]].
 

Emery, C., 1895:
 - Vrijburg, Bloemfontein. Identique aux exemplaires de Madagascar, sur lesquels j'ai fonde cette sous-espece.
 

Forel, A., 1912:
 [[ worker ]] [[ queen ]] [[ male ]]. Seychelles: Silhouette, Mare aux Cochons et Mont Pot-a-eau (1000 a 1500 pieds); Mahe, Anonyme Island, Cascade Estate, etc.
 

Fernández, F., 2008:
 (Fig. 5)
 Tramp species, in hothouses, Palaearctic, potentially to be imported to the New World.
 

Forel, A., 1894:
 Indische Art.
 Das nahezu totale Fehlen von Dolichoderiden in der afrikanischen Fauna ist einer ihrer auffaelligsten Zuege. Ich kenne keine einzige Art dieser Subfamilie, die der afrikanischen Fauna eigen waere. Ebensowenig gibt es eigene afrikanische Prenolepis-Arten, waehrend Madagascar sehr reich an eigenen Arten dieser Gattung ist.
 

Forel, A., 1895:
 - Forme de l'Inde et de Madagascar.
 

Forel, A., 1904:
 Lombok, Sapit, 2000 ' h., 11 [[ worker ]], Mai - Juin 1896 (Fruhstorfer!).
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

- Vrijburg, Bloemfontein. Identique aux exemplaires de Madagascar, sur lesquels j'ai fonde cette sous-espece.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indische Art.

 

Das nahezu totale Fehlen von Dolichoderiden in der afrikanischen Fauna ist einer ihrer auffaelligsten Zuege. Ich kenne keine einzige Art dieser Subfamilie, die der afrikanischen Fauna eigen waere. Ebensowenig gibt es eigene afrikanische Prenolepis-Arten, waehrend Madagascar sehr reich an eigenen Arten dieser Gattung ist.

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Technomyrmex sp. 1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Technomyrmex albipes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 26 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATANTATATTTTATTTTTGCTATTTGATCAGGAATAATTGGATCCTCTATAAGAATAATTATTCGTATTGAATTAGGAACTTGTAATTCCTTAATTAATAATGATCAAATCTACAACTCTATTGTTACAAGTCACGCATTTATTATAATTTTTTTTATAGTTATACCATTTATAATCGGTGGGTTTGGAAATTTTTTAGTTCCTTTGATATTAGGGGCCCCAGACATAGCATATCCACGAATAAATAATATAAGATTTTGACTATTACCACCCTCTATTATTATATTAACTATTAGTAATTTAATTGGATCAGGAGTTGGTACCGGATGAACAGTATACCCACCTCTATCATCAAATATTTACCATAATGGACCCTCAGTAGATTTAGCAATTTTTTCTCTTCATATTGCTGGAATATCATCAATCCTAGGAGCTATTAATTTTATTTCAACTATTTTAAACATACACCATAAAAACTTAACTTTAGATAAAATTCCTTTATTAGTCTGATCTATTTTAATTACTGCAATTCTTTTATTACTCTCCCTTCCTGTTTTAGCTGGAGCTATCACCATACTTCTTACAGATCGTAATATTAATACCTCATTTTTTGACCCATGTGGTGGGGGAGACCCAATTTTATATCAACACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Technomyrmex albipes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 27
Specimens with Barcodes: 126
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!