Articles on this page are available in 2 other languages: German (1), French (1) (learn more)

Overview

Comprehensive Description

Taxonomic History

Formica latipes Walsh, 1863 PDF: 311 (w.q.m.) U.S.A. AntCat AntWiki

Taxonomic history

Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Sandy areas in glaciated region
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lasius latipes (Walsh HNS 1863)

  • Ward, P. S. (2005): A synoptic review of the ants of California (Hymenoptera: Formicidae). Zootaxa 936, 1-68: null, URL:http://antbase.org/ants/publications/21008/21008.pdf
Public Domain

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NEARCTIC: USA (AZ, MA)
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Forel, A., 1886:
  [[ queen ]]. A la description de Mayr (Verh. k. k. zool. bot. Ges Wien, 1866, p. 889) j'ai a ajouter que les ailes sont comme chez les autres Lasius , mais assez etroites et mediocrement enfumees de brunatre.
 Etats-Unis (coll. de Saussure).
 

Mayr, G., 1866:
 Femina: Long. corp. sine abdomine 6 mm. Nitida, rufo-flava, mandibularem margine masticatorio nigro, pronoto antice, mesonoto antice et lateraliter, metanoto et petioli squama fuscescentibus; copiose flavidopilosa, femoribus sparse, tibiis tarsisque haud pilosis; caput sublaeve, quadrangulare, longius quam latius, thorace paululum angustius; mandibulae laevigatae ante apicem disperse fortiter punetatae; antennarum scapus et funiculus valde clavati; pronotum subopacum, mesonotum, scutellum et metanotum nitida et laevia; petiolus cum squama erecta, mediocriter crassa, subquadrata, angulis rotundatis, marginibus incrassatis et margine superiori medio indistincte emarginato; femora et tibiae valde compressa et fortiter dilatata; tarsi breves et non compressi.
 Visconsin (Mus. Holm.). Dem Exemplare fehlen die Fluegel und der Hinterleib.
  Beim ersten Anblicke dieser Art glaubte ich, eine neue Gattung vor mir zu haben, denn die aussergewoehnlich zusammengedrueckten Schenkel und Schienen geben dem Thiere ein ganz eigenthuemliches Aussehen. Wenn man aber die Beine, welche, wie z. B. bei Camponotus , grossem Wechsel bei derselben Gattung unterworfen sind, nicht in Ruecksicht bringt, so reiht sich diese Art zunaechst an L. (Acanthomyops) claviger , nur sind bei L. latipes die Fuehler noch mehr keulenfoermig verdickt. Da nun die abgeplatteten Beine kein wesentliches Merkmal abgeben koennen, und da sich in Bezug der verdickten Fuehler durch L. claviger und interjectus der allmaelige Uebergang zu den europaeischen LasiusArten herstellen laesst, so kann ich diese Art nur zur Gattung Lasius stellen. Ich glaube kaum, dass die bisher noch unbekannten Arbeiter und Maennchen, oder die Fluegel des Weibchens Merkmale zeigen werden, welche die Abtrennung von Lasius erfordern.
 

Ward, P. S., 2005:
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

[[ queen ]]. A la description de Mayr (Verh. k. k. zool. bot. Ges Wien, 1866, p. 889) j'ai a ajouter que les ailes sont comme chez les autres Lasius , mais assez etroites et mediocrement enfumees de brunatre.

 

Etats-Unis (coll. de Saussure).

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Femina: Long. corp. sine abdomine 6 mm. Nitida, rufo-flava, mandibularem margine masticatorio nigro, pronoto antice, mesonoto antice et lateraliter, metanoto et petioli squama fuscescentibus; copiose flavidopilosa, femoribus sparse, tibiis tarsisque haud pilosis; caput sublaeve, quadrangulare, longius quam latius, thorace paululum angustius; mandibulae laevigatae ante apicem disperse fortiter punetatae; antennarum scapus et funiculus valde clavati; pronotum subopacum, mesonotum, scutellum et metanotum nitida et laevia; petiolus cum squama erecta, mediocriter crassa, subquadrata, angulis rotundatis, marginibus incrassatis et margine superiori medio indistincte emarginato; femora et tibiae valde compressa et fortiter dilatata; tarsi breves et non compressi.

 

Visconsin (Mus. Holm.). Dem Exemplare fehlen die Fluegel und der Hinterleib.

 

Beim ersten Anblicke dieser Art glaubte ich, eine neue Gattung vor mir zu haben, denn die aussergewoehnlich zusammengedrueckten Schenkel und Schienen geben dem Thiere ein ganz eigenthuemliches Aussehen. Wenn man aber die Beine, welche, wie z. B. bei Camponotus , grossem Wechsel bei derselben Gattung unterworfen sind, nicht in Ruecksicht bringt, so reiht sich diese Art zunaechst an L. (Acanthomyops) claviger , nur sind bei L. latipes die Fuehler noch mehr keulenfoermig verdickt. Da nun die abgeplatteten Beine kein wesentliches Merkmal abgeben koennen, und da sich in Bezug der verdickten Fuehler durch L. claviger und interjectus der allmaelige Uebergang zu den europaeischen LasiusArten herstellen laesst, so kann ich diese Art nur zur Gattung Lasius stellen. Ich glaube kaum, dass die bisher noch unbekannten Arbeiter und Maennchen, oder die Fluegel des Weibchens Merkmale zeigen werden, welche die Abtrennung von Lasius erfordern.

License not applicable

Mayr, G.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Lasius latipes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acanthomyops latipes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Lasius latipes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTATTTTTTCTCTTCATATTGCAGGGATATCTTCTATTTTAGGAGCTATTAATTTTATTTCAACCATCATAAATATACATCATAAAAATTTTTCTATCGACAAAATACCCTTACTTGTATGGTCAATTTTAATCACTGCAATTTTGCTACTTTTATCTCTTCCCGTTCTTGCAGGA---GCTATCACTATACTTTTGACTGACCGAAATCTTAATACTTCATTTTTTGACCCCTCAGGAGGTGGGGACCCTATTTTATACCAACATCTTTTTTGATTTTTTGGTCACCCTGAAGTTTATATTTTAATCCTACCCGGATTTGGATTAATTTCTCATATTATTATAAATGAAAGAGGAAAAAAA---GAAACATTCGGATCCTTAGGAATAATTTATGCACTTATAGCAATTGGATTTTTAGGATTTGTTGTTTGAGCCCACCATATATTTACTATTGGGTTAGATGTTGATACTCGAGCATATTTTACTTCTGCAACTATAATTATTGCTATCCCAACAGGAATTAAAATTTTTAGATGAATTACC---ACTCTTCATGGAACA---AAAATCAATAATAATTCTTCTTTATGATGAACAATAGGATTCATTTTTCTATTCACTATAGGAGGACTTACAGGAGTTATACTTTCTAATTCATCAATTGACATTATTCTTCATGATACCTATTATGTAGTTGCTCATTTTCATTATGTA---TTATCAATAGGAGCAGTATTTGCTATTATTGCTAGATTTATCCATTGATTCCCTTTAATAACTGGCTTTTCTTTAAATAATTTTTTTCTAAATATTCAATTCATCTGTATATTTATTGGAGTAAATTTAACATTTTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
D2

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Social Insects Specialist Group

Reviewer/s

Contributor/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Acanthomyops latipes

Acanthomyops latipes is a species of ant in the family Formicidae. It is endemic to the United States.

References[edit]

  1. ^ Social Insects Specialist Group (1996). Acanthomyops latipes. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 24 February 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Subgenus: Acanthomyops.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!