Articles on this page are available in 2 other languages: French (4), German (1) (learn more)

Overview

Comprehensive Description

Taxonomic History

Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Reference for Kenya if not type: Gerstäcker 1871
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Forel, A., 1909:
 — Leopoldville (de Pauw); Bambaya, Guinee portugaise (Lucas).
 — [[ male ]]. -. Congo (Lemarinel).
 

Mayr, G., 1893:
 Sansibar. Eine spaerliche Vertretung der Maennchen dieser Gattung in meiner Sammlung machte eine sichere Determination zweifelhaft, so dass ich Muster der mir vorliegenden Sansibar-Exemplare an Prof. Emery, der sich bereits eingehend mit dieser Gattung beschaeftigt hatte, zur Determination sandte. Nur ein Exemplar, besonders etiquettirt, am 20. Oktober 1888 gefangen, entspricht der Shuckard'schen Beschreibung, waehrend die anderen Maennchen, gefangen Anfangs Juni 1888, dadurch abweichen, dass der Thorax nur an der Unterseite und am Metanotum abstehend behaart ist. Ein Exemplar, welches ich aus Gabun besitze, haelt zwischen beiden Formen die Mitte, indem der ganze Thorax wohl durchaus, aber nicht reichlich schief abstehend behaart ist.
 

Santschi, F., 1923:
  [[ male ]]. La variete type se distingue des autres en ce que le postpetiole (ou premier article du gastre) a de longs poils dresses sur les cotes comme le petiole, mais moins abondants; ils manquent presque totalement sur le dessus des quatre segments suivants, ce qui la distingue des varietes sudanicus Sants. et hirsutus Sants. Chez pulliceps la pilosite de l'abdomen est plutot comme chez le type mais la tete plus foncee, presque noire.
 Soudan egyptien: Haut Nil bleu, Roselees (C. Alluaud). - Soudan francais: Region de Zender, Bebeye (Dr. R. Gaillard). - Cote d'Ivoire: Dimbroko (Le Moult). - Congo belge: Kasai, Kondue, (E. Luja); Leopoldville (Dr. Mouchet) (Mus. de Tervueren).
 

Bernard, F., 1953:
  Assez frequent dans le massif: T 44 (Nion); T 42: Mont To, Camp I, 1.600 m.: cette derniere station est la plus riche en ouvrieres. Elles ne correspondent a aucune des varie- tes jusqu'ici decrites: leur ponctuation et la forme du petiole sont celles de la var. pulliceps Sant. de Cote d'Ivoire, mais la couleur, brun-acajou fonce, et la tete rappellent la race loewyi FOREL , de Zanzibar et Rhodesie nord.
 

Santschi, F., 1914:
 Ann. Mag. nat. Hist., vol. 5, p. 316 (1840), [[male]]. - Emery, apud P. Wytsman, Genera Insectorum, Formicidae, subfam. Dorylinae, fase. CII, p. 9 (1910).
  Afrique orientale anglaise: Mombasa (st. n° 3, nov. 1911), plusieurs [[worker]]; - lac Victoria-Nyanza, baie de Kavirondo, 1 [[worker]]; - Mail escarpment, entre El Burgon et Ndjoro (2.100 m., st. n° 24, dec. 1911), 3 [[worker]] et [[male]]. -La couleur sombre de ces exemplaires me fait supposer qu'ils sont peut-etre les ouvrieres de la var. exilis Santschi, dont le male seul est connu.
 Uganda: prov. d'Unyoro, pres Hoima (1909), 2 [[male]]; - reg. a l'est de l'Albert-Nyanza, 2 [[male]]; - Uganda central: M'Bale (1909), 3 [[male]].
  Rev. Suisse Zool., vol. 18, p. 744 (1910), [[male]] ( D. affinis , st. Lowyi, var. exilis ).
  C'est plutot une variete du D. affinis dont il differe surtout par sa couleur plus obscure, d'ailleurs assez variable, mais allant jusqu'au brun fonce; les cuisses sont d'un noiratre plus stable. La pilosite est comme chez D. affinis in sp. C'est la forme la plus frequente des Dorylus recoltes par MM. Alluaud et Jeannel.
 Certains exemplaires de Nairobi font passage a la st. Lowyi For.
 Afrique orientale anglaise: Nairobi (juill. 1903), 2 [[male]]; (st. n° 3, nov. 1911), 1 [[male]]; (oct. 1908), 1 [[male]]; - Rurunga, dans le pays Kikuyu (1.800 m., st. n°31, janv. 1912), 1 [[male]]; -Bura, dans les WaTaita(1.050 m., st. n°61, mars 1912), 4 [[male]]; - Taveta (750 m., st. no 65, mars 1912), 5 [[male]]; - -Mombasa (st. no 3, nov. 1911), 2 [[male]]; - prairies du Ngare Nyuki, dans la region du Kenya (fevr. 1909), 2 [[male]].
 Afrique orientale allemande: mont Kilimandjaro: Kiboscho (fevr. 1904), l[[male]] (type); - Neu-Moschi(800 m., st.no 72,avril 1912), 6 [[male]]; - riviere Himo (1.000 m., st. no 66, mars 1912), [[male]]; - Kilema(1.400 m., oct. 1908), 1 [[male]].
  [[male]]. - Long. 24 mill. Jaune brunatre clair. Tete jaune rougeatre. Mandibules, antennes et pattes rouge-brunatre. Une pubescence couchee, soyeuse comme chez la var. depilis , sur tout le thorax (sauf le bord dc l'epinotum). Tete transversale comme chez Lowyi For.; le 2e article du funicule court (plus court d'un cote que de l'autre, c'est un caractere assez inconstant chez Lowyi For.). Mandibules comme chez Lowyi. - Long, de la tete: 4 mill.; thorax: 4,3 mill.; aile anterieure: 18 mill. - Fait passage a D. Staudingeri Em. mais moins grand. Il differe de la race
 Lowyi par sa couleur et sa pilosite; les ailes sont aussi beaucoup plus claires que chez cette derniere race.
 Uganda: province d'Unyoro: region a l'est du lac AlbertNyanza(fevr. 1909), 1 [[male]] [type du Museum de Paris).:
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

[[ male ]]. La variete type se distingue des autres en ce que le postpetiole (ou premier article du gastre) a de longs poils dresses sur les cotes comme le petiole, mais moins abondants; ils manquent presque totalement sur le dessus des quatre segments suivants, ce qui la distingue des varietes sudanicus Sants. et hirsutus Sants. Chez pulliceps la pilosite de l'abdomen est plutot comme chez le type mais la tete plus foncee, presque noire.

 

Soudan egyptien: Haut Nil bleu, Roselees (C. Alluaud). - Soudan francais: Region de Zender, Bebeye (Dr. R. Gaillard). - Cote d'Ivoire: Dimbroko (Le Moult). - Congo belge: Kasai, Kondue, (E. Luja); Leopoldville (Dr. Mouchet) (Mus. de Tervueren).

License not applicable

Santschi, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

— [[ male ]]. -. Congo (Lemarinel).

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

— Leopoldville (de Pauw); Bambaya, Guinee portugaise (Lucas).

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sansibar. Eine spaerliche Vertretung der Maennchen dieser Gattung in meiner Sammlung machte eine sichere Determination zweifelhaft, so dass ich Muster der mir vorliegenden Sansibar-Exemplare an Prof. Emery, der sich bereits eingehend mit dieser Gattung beschaeftigt hatte, zur Determination sandte. Nur ein Exemplar, besonders etiquettirt, am 20. Oktober 1888 gefangen, entspricht der Shuckard'schen Beschreibung, waehrend die anderen Maennchen, gefangen Anfangs Juni 1888, dadurch abweichen, dass der Thorax nur an der Unterseite und am Metanotum abstehend behaart ist. Ein Exemplar, welches ich aus Gabun besitze, haelt zwischen beiden Formen die Mitte, indem der ganze Thorax wohl durchaus, aber nicht reichlich schief abstehend behaart ist.

License not applicable

Mayr, G.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Assez frequent dans le massif: T 44 (Nion); T 42: Mont To, Camp I, 1.600 m.: cette derniere station est la plus riche en ouvrieres. Elles ne correspondent a aucune des varie- tes jusqu'ici decrites: leur ponctuation et la forme du petiole sont celles de la var. pulliceps Sant. de Cote d'Ivoire, mais la couleur, brun-acajou fonce, et la tete rappellent la race loewyi FOREL , de Zanzibar et Rhodesie nord.

License not applicable

Bernard, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ann. Mag. nat. Hist., vol. 5, p. 316 (1840), [[male]]. - Emery, apud P. Wytsman, Genera Insectorum, Formicidae, subfam. Dorylinae, fase. CII, p. 9 (1910).

 

Afrique orientale anglaise: Mombasa (st. n° 3, nov. 1911), plusieurs [[worker]]; - lac Victoria-Nyanza, baie de Kavirondo, 1 [[worker]]; - Mail escarpment, entre El Burgon et Ndjoro (2.100 m., st. n° 24, dec. 1911), 3 [[worker]] et [[male]]. -La couleur sombre de ces exemplaires me fait supposer qu'ils sont peut-etre les ouvrieres de la var. exilis Santschi, dont le male seul est connu.

 

Uganda: prov. d'Unyoro, pres Hoima (1909), 2 [[male]]; - reg. a l'est de l'Albert-Nyanza, 2 [[male]]; - Uganda central: M'Bale (1909), 3 [[male]].

License not applicable

Santschi, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dorylus affinis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTTGCTTTATGATCAGGAATTCTTGGATCATCGATAAGAATAATTATTCGATTAGAACTAGGTACCTGCGGAAGAATAATTTTTAAC---GATCAAGTTTTTAATACTATTGTTACTAGGCATGCATTTATTATAATTTTTTTTATAGTTATACCATTTATAATTGGAGGTTTTGGAAACTTTATCGCACCTCTAATGATTGGAGCCCCTGATATGGCTTACCCTCGTATAAATAATATAAGATTTTGATTATTACCACCATCTATTACTCTTATAATTATAAGAAATTTTATCGGAACTGGGGCAGGAACAGGTTGAACTGTCTACCCTCCCTTAGCTTCAAATATTTATCATAGAGGAGCTTCTATTGATTTAACTATTTTTTCATTACACATTGCAGGTATATCTTCAATTTTAGGGGCAATTAATTTTATTTCAACAATTATTAATATACATCATAAAAATTTAACTATAGATAAGACACCCTTATTTGTTTGATCAATCCTAATTACAGCTATTCTTTTATTATTATCATTGCCTGTGTTAGCTGGAGCAATCACTATACTACTAACTGATCGTAATATTAATACTTCATTTTTTGATCCATCAGGAGGGGGCGACCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dorylus affinis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!