Overview

Comprehensive Description

General Description

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)

Body not very small. Proboscis sheath usually reaches nearly or quite to posterior end of body. Proboscis large; central stylet well developed. Ocelli usually numerous.

Short and broad. Usually two pouches of accessory stylets with 5 to 7 rather slender stylets each. Dark purplish or chocolate-brown above, with a triangular white spot on each side of the head; ventral surface pinkish or flesh-color.

Doubtfully referred to this species by Griffin; several varieties obtained. This species is abundant along the whole coast, from Bering Strait to Puget Sound.

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)
This large and conspicuous species is generally easily recognized by its clear dark purplish or chocolate-brown color above, with pale margins and a trapezoidal or triangular white spot on each side of the head and usually with a narrow white line across the neck; and by the pinkish or flesh-colored lower surface. Ocelli in two or more rows in an elongated groove on each antero-lateral margin of the head, and a pair of small sub-dorsal clusters on the transverse white nuchal band.
In ordinary state of contraction the body is rather short and stout. When disturbed it can become so greatly thickened anteriorly that its transverse diameter is fully 1/3 as great as its length. In extension the body is but moderately elongated, and is relatively broad and flat. It contracts very much s does a leech.
The Alaska specimens are commonly larger than have been recorded elsewhere, often measuring 200 mm or more in length and 10 mm in width.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Arctic south to Cape Cod and beyond in deep water, including Cobscook Bay
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sitka and Redout Bay, Alaska

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Blood Vascular System

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)
There is the usual anastomosis of the three longitudinal vessels, and of the pair of lateral nerve cords, above the hid gut and slightly in front of the anus. As seen from the figure, the union of the blood vessels is directly dorsal to that of the nerve cords.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Glands

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)
Cephalic glands:The cephalic glands open on the tip of the snout and are well developed. Sub-muscular glands, likewise, are remarkably abundant. They reach from the brain region well back towards the end of the esophagus. They are multicellular, each one being composed of upwards of a score of large, vacuolated cells with small nuclei situated on the side farthest from the lumen. Each gland has a twisted duct leading through the muscular layers, basement membrane, and integument, and opening to the exterior on the ventro-lateral aspects of the body.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sensory Organs

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)
Numerous and characteristic in arrangement. The dark pigment on the head, however, often renders them difficult of accurate determination. A pair of elongated clusters of ocelli lies on the antero-lateral margins of the head, and another smaller cluster on, or near, the angular white spot on each side of the head. EAch of the anterior clusters may contain upwards of 20 ocelli arranged in two or more irregular rows nearly parallel with the anterio-lateral margin of the head, while the posterior groups may consist of 8 to 15 similar ocelli. The posterior groups are situated deep in the tissues of the head. Of course the number of ocelli varies greatly in different individuals.
Cerebral sense organs:Well developed. They lie a little in front of the brain, beside the esophagus, and bell the cephalic blood lacunae. Each sees orange has a wide canal which leads a short distance anteriorly and opens ot the exterior on the latero-ventral aspect of the body. The brain itself is of large size, with a thick ventral and narrow dorsal commissure.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Excretory System

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)
The nephridia extend from near the brain well backward in the esophageal region. In one specimen there were two pairs of efferent ducts opening on the latero=ventral aspect of the body; in another only one pair.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Proboscis and Rhynchocoel System

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)
The proboscis is large, thick, and pale reddish or salmon in color. The smallest specimen collected had 17 nerves in the proboscis; four other specimens examined had each 18 proboscidial nerves, one had 19 nerves, and two others had 20 each. This shows more strikingly than has previously been pointed out that the number of nerves in the proboscis is variable to a very considerable extent. Buerger has shown that Drepanoporus crassus may have 19 or 20 nerves, and D. specabilis 24 or 26. Nevertheless in the other Alaska species the number has been found surprisingly constant. The number of nerves in any particular proboscis remains perfectly constant so far as I have observed from the anterior and back as far as the stylet region. Here they break up into a plexus and lose their identity. The nerves in A. angulatus enter the proboscis at its anterior attachment and in its ventral portion. They then divide into their definite number of branches (usually 18) which pass obliquely dorsally and arrange themselves symmetrically on the periphery. The proboscis sheath extends within a few sections of the posterior end of the body.
The armature of the proboscis is made up of a moderately slender central stylet, and (usually) two pouches of accessory stylets. The basis of the central stylet is about as long as the stylet itself. It is moderately slender, constricted near its middle, enlarged and rounded posteriorly. Each reserve pouch commonly contains 5 to 7 rather slender stylets, similar in size and shape to the central stylet.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Digestive System

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)

Beneath the esophagus a broad caecal appendage of the intestine stretches forward well toward the brain region. The caecum consists of a large median canal with pouch-like diverticula extending dorsally above the lateral nerve cords.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

benthic, living under rocks or in burrows in soft substrata, or crawling among algae, hydroids, or in bottom debris
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)
The species is extremely abundant along the whole Alaska coast as far west as Unalaska Island, and Stimpson records it fro Bering Strait. It is round under stones between tides in all sorts of situations. Stimpson's specimens came from a depth of five fathoms. The species is found on the Atlantic coast of North America from Massachusetts Bay to Greenland.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 55 - 73
  Temperature range (°C): -0.110 - 9.181
  Nitrate (umol/L): 2.799 - 7.566
  Salinity (PPS): 31.472 - 33.917
  Oxygen (ml/l): 5.713 - 7.519
  Phosphate (umol/l): 0.709 - 1.072
  Silicate (umol/l): 4.500 - 16.651

Graphical representation

Depth range (m): 55 - 73

Temperature range (°C): -0.110 - 9.181

Nitrate (umol/L): 2.799 - 7.566

Salinity (PPS): 31.472 - 33.917

Oxygen (ml/l): 5.713 - 7.519

Phosphate (umol/l): 0.709 - 1.072

Silicate (umol/l): 4.500 - 16.651
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

generally for group, they are carnivorous; in some cases only the body juices are ingested but the whole prey may be taken in. feed on protozoans, other microfauna and at times prey their own size
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Reproduction and Development

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)
The reproductive glands occur both above and below the alimentary canal. Sexual products were not nearly mature in June and July.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amphiporus angulatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TCTTTATATTTTTTATTTGGAGTTTGGTCTGGGCTGGTTGGTACGGCCCTTAGCCTCTTAATTCGTGCTGAGCTAGGGCAGCCCGGGGCTTTATTAGGAGAC---GATCAGCTGTATAATGTGATTGTAACTGCTCATGCTTTTGTAATAATTTTTTTTTTAGTTATACCAGTAATGATTGGTGGGTTTGGAAATTGGCTTGTTCCTCTAATACTGGGGGCCCCTGATATGGCCTTTCCTCGTATAAACAACATAAGCTTTTGGTTGTTACCGCCTGCTTTAACTCTTCTTTTGTCTTCTGGGGCAGTCGAGAGTGGGGCGGGCACGGGCTGGACTGTATACCCTCCTTTGTCTAGAAATATTGCGCATGCCGGAGGGTCTGTCGATTTGGCTATTTTTTCTCTTCACCTAGCTGGGGTCTCTTCCATTTTAGGTGCTATCAATTTTATTACTACTATTATTAACATGCGTTGGTATGGTATGCAGTTTGAGCGGTTGTCTTTATTTGTGTGATCTGTAAAAATCACGGCGATTCTTCTTCTTCTATCTTTGCCTGTATTAGCTGGGGCTATTACTATATTACTAACAGACCGAAATTTTAATACATCTTTTTTTGACCCTGCTGGTGGTGGGGATCCAATTTTGTATCAGCATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Amphiporus angulatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!